Incidental Mutation 'R0134:Smarca4'
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
SynonymsSNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location21616169-21704230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21637324 bp
Amino Acid Change Leucine to Proline at position 302 (L302P)
Ref Sequence ENSEMBL: ENSMUSP00000096547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
Predicted Effect probably damaging
Transcript: ENSMUST00000034707
AA Change: L302P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: L302P

low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098948
AA Change: L302P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: L302P

low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172996
AA Change: L106P
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: L106P

low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174008
AA Change: L302P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: L302P

low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21679073 missense probably benign 0.30
IGL01694:Smarca4 APN 9 21665870 missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21635703 missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21701090 missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21639239 missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21686122 missense probably benign 0.25
IGL02794:Smarca4 APN 9 21673342 splice site probably benign
IGL03030:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03037:Smarca4 APN 9 21632935 unclassified probably benign
IGL03069:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03355:Smarca4 APN 9 21635836 missense probably benign 0.14
R0123:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21700872 missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21636201 missense probably benign 0.09
R0631:Smarca4 UTSW 9 21658984 splice site probably benign
R0665:Smarca4 UTSW 9 21700943 small deletion probably benign
R0726:Smarca4 UTSW 9 21700139 critical splice donor site probably null
R0801:Smarca4 UTSW 9 21642554 missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21636215 missense probably benign 0.16
R1411:Smarca4 UTSW 9 21658955 missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21700943 small deletion probably benign
R1768:Smarca4 UTSW 9 21701183 missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21677480 missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21686062 missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21686029 missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21635698 missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21642580 missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21672059 missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21639327 missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21660763 missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21655706 missense probably benign 0.01
R5785:Smarca4 UTSW 9 21686026 missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21677942 intron probably benign
R5964:Smarca4 UTSW 9 21647430 missense probably benign 0.00
R6001:Smarca4 UTSW 9 21632909 unclassified probably benign
R6072:Smarca4 UTSW 9 21700121 missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21699877 missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21637375 missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21679149 critical splice donor site probably null
R6461:Smarca4 UTSW 9 21679020 missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21658831 missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21634820 missense probably benign 0.10
R7253:Smarca4 UTSW 9 21658960 missense probably benign 0.01
R7307:Smarca4 UTSW 9 21638800 missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21658933 missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21686247 missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21647625 missense possibly damaging 0.82
R7573:Smarca4 UTSW 9 21639075 intron probably null
R7644:Smarca4 UTSW 9 21655654 missense probably benign 0.00
R7734:Smarca4 UTSW 9 21667362 missense possibly damaging 0.65
R7833:Smarca4 UTSW 9 21647359 missense possibly damaging 0.86
R8085:Smarca4 UTSW 9 21658812 splice site probably null
R8119:Smarca4 UTSW 9 21647626 missense possibly damaging 0.61
R8320:Smarca4 UTSW 9 21677502 missense probably benign 0.10
Z1176:Smarca4 UTSW 9 21702957 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcagaacagcacacaatagaaac -3'
Posted On2013-04-12