Incidental Mutation 'R1965:Timm44'
ID218285
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Nametranslocase of inner mitochondrial membrane 44
SynonymsMimt44, 0710005E20Rik, Tim44, D8Ertd118e
MMRRC Submission 039978-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1965 (G1)
Quality Score223
Status Not validated
Chromosome8
Chromosomal Location4259731-4275913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4260603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 383 (M383T)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029] [ENSMUST00000011981] [ENSMUST00000053252] [ENSMUST00000208316] [ENSMUST00000208459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003029
AA Change: M383T

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: M383T

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000011981
SMART Domains Protein: ENSMUSP00000011981
Gene: ENSMUSG00000011837

DomainStartEndE-ValueType
Pfam:SnAPC_2_like 1 356 5.9e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053252
SMART Domains Protein: ENSMUSP00000057115
Gene: ENSMUSG00000048644

DomainStartEndE-ValueType
Pfam:Cortexin 7 82 7.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149827
Predicted Effect probably benign
Transcript: ENSMUST00000208110
Predicted Effect probably benign
Transcript: ENSMUST00000208316
Predicted Effect probably benign
Transcript: ENSMUST00000208459
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,346,234 D32E probably damaging Het
1700042G07Rik G A 4: 116,174,179 C82Y probably damaging Het
Aco1 T G 4: 40,175,730 L157R probably damaging Het
Acot11 A T 4: 106,749,353 L513Q probably damaging Het
Amd1 A G 10: 40,294,759 I52T probably benign Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arel1 T A 12: 84,940,399 probably null Het
Arg1 T A 10: 24,916,864 probably null Het
Atf1 A T 15: 100,254,171 M135L probably benign Het
Atf2 T C 2: 73,850,898 E77G possibly damaging Het
Axin1 G T 17: 26,184,225 A394S probably damaging Het
Axin1 A T 17: 26,190,228 Q734L probably damaging Het
Brd8 G C 18: 34,602,766 A886G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Celf3 T C 3: 94,485,327 V35A probably damaging Het
Ckap2 T C 8: 22,175,787 T415A possibly damaging Het
Crybg3 T C 16: 59,503,237 Y1066C probably damaging Het
Csmd3 T C 15: 47,849,748 H1506R probably benign Het
Dnah10 A G 5: 124,775,203 D1808G probably damaging Het
Dsc3 C T 18: 19,980,672 G398R probably damaging Het
Emc2 A G 15: 43,527,467 Q293R probably damaging Het
Evc2 A G 5: 37,363,532 N251D possibly damaging Het
Fam151a A T 4: 106,733,915 probably benign Het
Fam208a T G 14: 27,442,554 C272W probably damaging Het
Fbxw16 T A 9: 109,441,221 I151F probably damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Foxc2 T A 8: 121,116,674 S20R probably damaging Het
Fpr-rs6 C T 17: 20,182,656 G148R probably damaging Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Fyb2 A T 4: 104,913,649 I54F probably benign Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gldc G A 19: 30,137,113 R466* probably null Het
Gm12695 T A 4: 96,762,845 S124C probably benign Het
Gm4846 A T 1: 166,486,964 I370N possibly damaging Het
Gsdmc3 T C 15: 63,858,447 T423A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnmb3 T C 3: 32,472,343 Y233C probably damaging Het
Kidins220 A G 12: 24,994,906 D191G probably damaging Het
Kmt2a A G 9: 44,821,460 probably benign Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Myo1f C T 17: 33,598,172 R730* probably null Het
Ncoa7 C A 10: 30,654,430 E30* probably null Het
Neurod4 T A 10: 130,271,049 K119* probably null Het
Npy5r T C 8: 66,681,277 D288G probably benign Het
Nr3c2 A T 8: 76,909,463 I398L probably damaging Het
Olfr1002 T C 2: 85,647,746 T192A possibly damaging Het
Olfr1151 A G 2: 87,857,415 K80R probably benign Het
Olfr1160 A G 2: 88,006,304 F149S probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr1277 T C 2: 111,269,593 Y258C probably damaging Het
Olfr533 C A 7: 140,466,661 F153L probably benign Het
Olfr624 A T 7: 103,670,896 I45N probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Pcf11 A T 7: 92,661,601 M393K probably benign Het
Pck2 T C 14: 55,542,507 V71A probably benign Het
Pdzd8 G T 19: 59,300,122 L949I probably benign Het
Pdzrn4 G A 15: 92,746,309 probably null Het
Phospho1 A G 11: 95,830,879 N125S probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Ppid A T 3: 79,602,299 K308* probably null Het
Ppp1r1b A G 11: 98,355,363 E57G probably damaging Het
Prtg T G 9: 72,848,322 S269A probably benign Het
Rbbp5 T A 1: 132,494,297 S312T probably damaging Het
Rbm11 T A 16: 75,598,768 probably null Het
Retreg1 A G 15: 25,970,164 T139A probably damaging Het
Riok3 T A 18: 12,136,962 H120Q probably damaging Het
Rln1 A T 19: 29,334,595 M1K probably null Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Sccpdh C T 1: 179,684,314 P117L probably damaging Het
Serac1 T C 17: 6,048,999 K506E possibly damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Slc1a2 T A 2: 102,739,900 N174K probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Slc46a2 T A 4: 59,914,249 S225C probably damaging Het
Smarcc2 G A 10: 128,474,758 E419K probably damaging Het
Stkld1 T A 2: 26,946,732 probably null Het
Szt2 A G 4: 118,383,965 M1704T probably benign Het
Tfcp2l1 C T 1: 118,652,923 Q116* probably null Het
Tnpo2 G A 8: 85,045,317 probably null Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Wdfy3 A G 5: 101,951,312 L290P probably damaging Het
Wdr59 A G 8: 111,451,077 F898L probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp879 A T 11: 50,833,528 C234S probably damaging Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4275888 utr 5 prime probably benign
IGL01768:Timm44 APN 8 4266860 missense probably benign 0.00
IGL02336:Timm44 APN 8 4267692 missense probably damaging 1.00
R0505:Timm44 UTSW 8 4260532 nonsense probably null
R0883:Timm44 UTSW 8 4266592 missense probably benign
R1842:Timm44 UTSW 8 4260510 critical splice donor site probably null
R2243:Timm44 UTSW 8 4267871 missense possibly damaging 0.91
R2318:Timm44 UTSW 8 4268307 missense probably benign 0.18
R2518:Timm44 UTSW 8 4266588 missense probably null 1.00
R4049:Timm44 UTSW 8 4260561 missense probably benign 0.00
R4489:Timm44 UTSW 8 4266654 missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4267932 missense probably damaging 0.99
R5001:Timm44 UTSW 8 4275886 start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4275919 splice site probably null
R5335:Timm44 UTSW 8 4266814 missense probably damaging 1.00
R5502:Timm44 UTSW 8 4269992 missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4266769 critical splice donor site probably null
R5700:Timm44 UTSW 8 4274171 missense probably damaging 1.00
R6004:Timm44 UTSW 8 4267747 missense probably benign 0.00
R6186:Timm44 UTSW 8 4266824 missense probably damaging 1.00
R6524:Timm44 UTSW 8 4267988 missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4267282 missense probably damaging 1.00
R6996:Timm44 UTSW 8 4266611 missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4267311 missense probably damaging 0.98
R7844:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
R8209:Timm44 UTSW 8 4266844 missense probably benign 0.02
R8532:Timm44 UTSW 8 4260549 missense possibly damaging 0.63
Z1088:Timm44 UTSW 8 4268004 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGATGAAACGGTGCTCTG -3'
(R):5'- ACTCCTCTAAAGTCGGGGAG -3'

Sequencing Primer
(F):5'- CAGATGAAACGGTGCTCTGACTTC -3'
(R):5'- TCGGGGAGGGTGGTACCATAC -3'
Posted On2014-08-01