Incidental Mutation 'R1965:Tnpo2'
ID218289
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Nametransportin 2 (importin 3, karyopherin beta 2b)
SynonymsKpnb2b, TRN2, 1110034O24Rik
MMRRC Submission 039978-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1965 (G1)
Quality Score93
Status Not validated
Chromosome8
Chromosomal Location85036915-85057583 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 85045317 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000166592] [ENSMUST00000166592] [ENSMUST00000210945] [ENSMUST00000211601] [ENSMUST00000211601]
Predicted Effect probably null
Transcript: ENSMUST00000093360
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104339
Predicted Effect probably null
Transcript: ENSMUST00000166592
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166592
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Predicted Effect probably benign
Transcript: ENSMUST00000210945
Predicted Effect probably null
Transcript: ENSMUST00000211601
Predicted Effect probably null
Transcript: ENSMUST00000211601
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,346,234 D32E probably damaging Het
1700042G07Rik G A 4: 116,174,179 C82Y probably damaging Het
Aco1 T G 4: 40,175,730 L157R probably damaging Het
Acot11 A T 4: 106,749,353 L513Q probably damaging Het
Amd1 A G 10: 40,294,759 I52T probably benign Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arel1 T A 12: 84,940,399 probably null Het
Arg1 T A 10: 24,916,864 probably null Het
Atf1 A T 15: 100,254,171 M135L probably benign Het
Atf2 T C 2: 73,850,898 E77G possibly damaging Het
Axin1 G T 17: 26,184,225 A394S probably damaging Het
Axin1 A T 17: 26,190,228 Q734L probably damaging Het
Brd8 G C 18: 34,602,766 A886G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Celf3 T C 3: 94,485,327 V35A probably damaging Het
Ckap2 T C 8: 22,175,787 T415A possibly damaging Het
Crybg3 T C 16: 59,503,237 Y1066C probably damaging Het
Csmd3 T C 15: 47,849,748 H1506R probably benign Het
Dnah10 A G 5: 124,775,203 D1808G probably damaging Het
Dsc3 C T 18: 19,980,672 G398R probably damaging Het
Emc2 A G 15: 43,527,467 Q293R probably damaging Het
Evc2 A G 5: 37,363,532 N251D possibly damaging Het
Fam151a A T 4: 106,733,915 probably benign Het
Fam208a T G 14: 27,442,554 C272W probably damaging Het
Fbxw16 T A 9: 109,441,221 I151F probably damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Foxc2 T A 8: 121,116,674 S20R probably damaging Het
Fpr-rs6 C T 17: 20,182,656 G148R probably damaging Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Fyb2 A T 4: 104,913,649 I54F probably benign Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gldc G A 19: 30,137,113 R466* probably null Het
Gm12695 T A 4: 96,762,845 S124C probably benign Het
Gm4846 A T 1: 166,486,964 I370N possibly damaging Het
Gsdmc3 T C 15: 63,858,447 T423A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnmb3 T C 3: 32,472,343 Y233C probably damaging Het
Kidins220 A G 12: 24,994,906 D191G probably damaging Het
Kmt2a A G 9: 44,821,460 probably benign Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Myo1f C T 17: 33,598,172 R730* probably null Het
Ncoa7 C A 10: 30,654,430 E30* probably null Het
Neurod4 T A 10: 130,271,049 K119* probably null Het
Npy5r T C 8: 66,681,277 D288G probably benign Het
Nr3c2 A T 8: 76,909,463 I398L probably damaging Het
Olfr1002 T C 2: 85,647,746 T192A possibly damaging Het
Olfr1151 A G 2: 87,857,415 K80R probably benign Het
Olfr1160 A G 2: 88,006,304 F149S probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr1277 T C 2: 111,269,593 Y258C probably damaging Het
Olfr533 C A 7: 140,466,661 F153L probably benign Het
Olfr624 A T 7: 103,670,896 I45N probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Pcf11 A T 7: 92,661,601 M393K probably benign Het
Pck2 T C 14: 55,542,507 V71A probably benign Het
Pdzd8 G T 19: 59,300,122 L949I probably benign Het
Pdzrn4 G A 15: 92,746,309 probably null Het
Phospho1 A G 11: 95,830,879 N125S probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Ppid A T 3: 79,602,299 K308* probably null Het
Ppp1r1b A G 11: 98,355,363 E57G probably damaging Het
Prtg T G 9: 72,848,322 S269A probably benign Het
Rbbp5 T A 1: 132,494,297 S312T probably damaging Het
Rbm11 T A 16: 75,598,768 probably null Het
Retreg1 A G 15: 25,970,164 T139A probably damaging Het
Riok3 T A 18: 12,136,962 H120Q probably damaging Het
Rln1 A T 19: 29,334,595 M1K probably null Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Sccpdh C T 1: 179,684,314 P117L probably damaging Het
Serac1 T C 17: 6,048,999 K506E possibly damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Slc1a2 T A 2: 102,739,900 N174K probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Slc46a2 T A 4: 59,914,249 S225C probably damaging Het
Smarcc2 G A 10: 128,474,758 E419K probably damaging Het
Stkld1 T A 2: 26,946,732 probably null Het
Szt2 A G 4: 118,383,965 M1704T probably benign Het
Tfcp2l1 C T 1: 118,652,923 Q116* probably null Het
Timm44 A G 8: 4,260,603 M383T possibly damaging Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Wdfy3 A G 5: 101,951,312 L290P probably damaging Het
Wdr59 A G 8: 111,451,077 F898L probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp879 A T 11: 50,833,528 C234S probably damaging Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85040526 missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85050508 missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85050502 missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85045067 missense probably benign
IGL02644:Tnpo2 APN 8 85044480 missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85054690 critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85045080 missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85051718 missense possibly damaging 0.75
R0127:Tnpo2 UTSW 8 85040628 missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85054416 missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85047362 missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85053529 missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85050157 missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85052041 nonsense probably null
R1113:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85051772 missense probably damaging 1.00
R2057:Tnpo2 UTSW 8 85050113 missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85053846 missense probably benign 0.35
R3801:Tnpo2 UTSW 8 85055171 splice site probably null
R3871:Tnpo2 UTSW 8 85054751 missense probably null 0.98
R4095:Tnpo2 UTSW 8 85038419 missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85053803 missense probably benign 0.38
R4925:Tnpo2 UTSW 8 85050025 missense probably damaging 1.00
R5744:Tnpo2 UTSW 8 85051894 nonsense probably null
R6107:Tnpo2 UTSW 8 85053475 missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85055404 missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85045202 missense possibly damaging 0.83
R7173:Tnpo2 UTSW 8 85055078 missense probably benign 0.05
R7196:Tnpo2 UTSW 8 85047137 missense possibly damaging 0.91
R7382:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7383:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7384:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7385:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7453:Tnpo2 UTSW 8 85055022 missense probably damaging 1.00
R7488:Tnpo2 UTSW 8 85055034 missense probably benign 0.03
R7638:Tnpo2 UTSW 8 85044415 missense probably benign 0.01
R8004:Tnpo2 UTSW 8 85044699 missense probably benign 0.26
R8021:Tnpo2 UTSW 8 85055206 missense probably damaging 1.00
R8042:Tnpo2 UTSW 8 85051559 missense probably damaging 1.00
R8403:Tnpo2 UTSW 8 85047297 missense probably benign 0.02
X0027:Tnpo2 UTSW 8 85044895 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAATGCTCAATACCAAGGGC -3'
(R):5'- GCCTTCATCTGCTTAAGGGTTG -3'

Sequencing Primer
(F):5'- TGCTCAATACCAAGGGCTAGTG -3'
(R):5'- ATTATGTAACCCAGGCTGGC -3'
Posted On2014-08-01