Mutagenetix > Incidental Mutations

Incidental Mutation 'R1965:Ap2b1'

218301

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

039978-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83346895 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 557 (I557T)

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: I595T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I595T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: I595T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I595T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably benign
Transcript: ENSMUST00000176430
AA Change: I595T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I595T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523
AA Change: I557T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: I557T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	T	A	5: 98,346,234	D32E	probably damaging	Het
1700042G07Rik	G	A	4: 116,174,179	C82Y	probably damaging	Het
Aco1	T	G	4: 40,175,730	L157R	probably damaging	Het
Acot11	A	T	4: 106,749,353	L513Q	probably damaging	Het
Amd1	A	G	10: 40,294,759	I52T	probably benign	Het
Arel1	T	A	12: 84,940,399		probably null	Het
Arg1	T	A	10: 24,916,864		probably null	Het
Atf1	A	T	15: 100,254,171	M135L	probably benign	Het
Atf2	T	C	2: 73,850,898	E77G	possibly damaging	Het
Axin1	G	T	17: 26,184,225	A394S	probably damaging	Het
Axin1	A	T	17: 26,190,228	Q734L	probably damaging	Het
Brd8	G	C	18: 34,602,766	A886G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Celf3	T	C	3: 94,485,327	V35A	probably damaging	Het
Ckap2	T	C	8: 22,175,787	T415A	possibly damaging	Het
Crybg3	T	C	16: 59,503,237	Y1066C	probably damaging	Het
Csmd3	T	C	15: 47,849,748	H1506R	probably benign	Het
Dnah10	A	G	5: 124,775,203	D1808G	probably damaging	Het
Dsc3	C	T	18: 19,980,672	G398R	probably damaging	Het
Emc2	A	G	15: 43,527,467	Q293R	probably damaging	Het
Evc2	A	G	5: 37,363,532	N251D	possibly damaging	Het
Fam151a	A	T	4: 106,733,915		probably benign	Het
Fam208a	T	G	14: 27,442,554	C272W	probably damaging	Het
Fbxw16	T	A	9: 109,441,221	I151F	probably damaging	Het
Fmnl2	A	G	2: 53,114,868	D658G	probably damaging	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Foxc2	T	A	8: 121,116,674	S20R	probably damaging	Het
Fpr-rs6	C	T	17: 20,182,656	G148R	probably damaging	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Fyb2	A	T	4: 104,913,649	I54F	probably benign	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gldc	G	A	19: 30,137,113	R466*	probably null	Het
Gm12695	T	A	4: 96,762,845	S124C	probably benign	Het
Gm4846	A	T	1: 166,486,964	I370N	possibly damaging	Het
Gsdmc3	T	C	15: 63,858,447	T423A	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcnmb3	T	C	3: 32,472,343	Y233C	probably damaging	Het
Kidins220	A	G	12: 24,994,906	D191G	probably damaging	Het
Kmt2a	A	G	9: 44,821,460		probably benign	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Myo1f	C	T	17: 33,598,172	R730*	probably null	Het
Ncoa7	C	A	10: 30,654,430	E30*	probably null	Het
Neurod4	T	A	10: 130,271,049	K119*	probably null	Het
Npy5r	T	C	8: 66,681,277	D288G	probably benign	Het
Nr3c2	A	T	8: 76,909,463	I398L	probably damaging	Het
Olfr1002	T	C	2: 85,647,746	T192A	possibly damaging	Het
Olfr1151	A	G	2: 87,857,415	K80R	probably benign	Het
Olfr1160	A	G	2: 88,006,304	F149S	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr1277	T	C	2: 111,269,593	Y258C	probably damaging	Het
Olfr533	C	A	7: 140,466,661	F153L	probably benign	Het
Olfr624	A	T	7: 103,670,896	I45N	probably damaging	Het
Olfr713	T	C	7: 107,036,358	S68P	probably damaging	Het
Pcf11	A	T	7: 92,661,601	M393K	probably benign	Het
Pck2	T	C	14: 55,542,507	V71A	probably benign	Het
Pdzd8	G	T	19: 59,300,122	L949I	probably benign	Het
Pdzrn4	G	A	15: 92,746,309		probably null	Het
Phospho1	A	G	11: 95,830,879	N125S	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Ppp1r1b	A	G	11: 98,355,363	E57G	probably damaging	Het
Prtg	T	G	9: 72,848,322	S269A	probably benign	Het
Rbbp5	T	A	1: 132,494,297	S312T	probably damaging	Het
Rbm11	T	A	16: 75,598,768		probably null	Het
Retreg1	A	G	15: 25,970,164	T139A	probably damaging	Het
Riok3	T	A	18: 12,136,962	H120Q	probably damaging	Het
Rln1	A	T	19: 29,334,595	M1K	probably null	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Sccpdh	C	T	1: 179,684,314	P117L	probably damaging	Het
Serac1	T	C	17: 6,048,999	K506E	possibly damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Slc1a2	T	A	2: 102,739,900	N174K	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Slc46a2	T	A	4: 59,914,249	S225C	probably damaging	Het
Smarcc2	G	A	10: 128,474,758	E419K	probably damaging	Het
Stkld1	T	A	2: 26,946,732		probably null	Het
Szt2	A	G	4: 118,383,965	M1704T	probably benign	Het
Tfcp2l1	C	T	1: 118,652,923	Q116*	probably null	Het
Timm44	A	G	8: 4,260,603	M383T	possibly damaging	Het
Tnpo2	G	A	8: 85,045,317		probably null	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Wdfy3	A	G	5: 101,951,312	L290P	probably damaging	Het
Wdr59	A	G	8: 111,451,077	F898L	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zfp879	A	T	11: 50,833,528	C234S	probably damaging	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGTGGTGTTGTCTGAGAAGCC -3'
(R):5'- ACCAGGGACTTAAGCAACTTCC -3'

Sequencing Primer
(F):5'- CTGAGAAGCCATTGATCTCTGAG -3'
(R):5'- ACAGGTAATATTCATCGCAATTGTC -3'

Posted On

2014-08-01