Incidental Mutation 'R1965:Tnrc6b'
ID218316
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission 039978-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1965 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80880439 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 714 (K714R)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: K714R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: K714R

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228320
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,346,234 D32E probably damaging Het
1700042G07Rik G A 4: 116,174,179 C82Y probably damaging Het
Aco1 T G 4: 40,175,730 L157R probably damaging Het
Acot11 A T 4: 106,749,353 L513Q probably damaging Het
Amd1 A G 10: 40,294,759 I52T probably benign Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arel1 T A 12: 84,940,399 probably null Het
Arg1 T A 10: 24,916,864 probably null Het
Atf1 A T 15: 100,254,171 M135L probably benign Het
Atf2 T C 2: 73,850,898 E77G possibly damaging Het
Axin1 G T 17: 26,184,225 A394S probably damaging Het
Axin1 A T 17: 26,190,228 Q734L probably damaging Het
Brd8 G C 18: 34,602,766 A886G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Celf3 T C 3: 94,485,327 V35A probably damaging Het
Ckap2 T C 8: 22,175,787 T415A possibly damaging Het
Crybg3 T C 16: 59,503,237 Y1066C probably damaging Het
Csmd3 T C 15: 47,849,748 H1506R probably benign Het
Dnah10 A G 5: 124,775,203 D1808G probably damaging Het
Dsc3 C T 18: 19,980,672 G398R probably damaging Het
Emc2 A G 15: 43,527,467 Q293R probably damaging Het
Evc2 A G 5: 37,363,532 N251D possibly damaging Het
Fam151a A T 4: 106,733,915 probably benign Het
Fam208a T G 14: 27,442,554 C272W probably damaging Het
Fbxw16 T A 9: 109,441,221 I151F probably damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Foxc2 T A 8: 121,116,674 S20R probably damaging Het
Fpr-rs6 C T 17: 20,182,656 G148R probably damaging Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Fyb2 A T 4: 104,913,649 I54F probably benign Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gldc G A 19: 30,137,113 R466* probably null Het
Gm12695 T A 4: 96,762,845 S124C probably benign Het
Gm4846 A T 1: 166,486,964 I370N possibly damaging Het
Gsdmc3 T C 15: 63,858,447 T423A probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcnmb3 T C 3: 32,472,343 Y233C probably damaging Het
Kidins220 A G 12: 24,994,906 D191G probably damaging Het
Kmt2a A G 9: 44,821,460 probably benign Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lrba A G 3: 86,605,868 probably null Het
Myo1f C T 17: 33,598,172 R730* probably null Het
Ncoa7 C A 10: 30,654,430 E30* probably null Het
Neurod4 T A 10: 130,271,049 K119* probably null Het
Npy5r T C 8: 66,681,277 D288G probably benign Het
Nr3c2 A T 8: 76,909,463 I398L probably damaging Het
Olfr1002 T C 2: 85,647,746 T192A possibly damaging Het
Olfr1151 A G 2: 87,857,415 K80R probably benign Het
Olfr1160 A G 2: 88,006,304 F149S probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr1277 T C 2: 111,269,593 Y258C probably damaging Het
Olfr533 C A 7: 140,466,661 F153L probably benign Het
Olfr624 A T 7: 103,670,896 I45N probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Pcf11 A T 7: 92,661,601 M393K probably benign Het
Pck2 T C 14: 55,542,507 V71A probably benign Het
Pdzd8 G T 19: 59,300,122 L949I probably benign Het
Pdzrn4 G A 15: 92,746,309 probably null Het
Phospho1 A G 11: 95,830,879 N125S probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Ppid A T 3: 79,602,299 K308* probably null Het
Ppp1r1b A G 11: 98,355,363 E57G probably damaging Het
Prtg T G 9: 72,848,322 S269A probably benign Het
Rbbp5 T A 1: 132,494,297 S312T probably damaging Het
Rbm11 T A 16: 75,598,768 probably null Het
Retreg1 A G 15: 25,970,164 T139A probably damaging Het
Riok3 T A 18: 12,136,962 H120Q probably damaging Het
Rln1 A T 19: 29,334,595 M1K probably null Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Sccpdh C T 1: 179,684,314 P117L probably damaging Het
Serac1 T C 17: 6,048,999 K506E possibly damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Slc1a2 T A 2: 102,739,900 N174K probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Slc46a2 T A 4: 59,914,249 S225C probably damaging Het
Smarcc2 G A 10: 128,474,758 E419K probably damaging Het
Stkld1 T A 2: 26,946,732 probably null Het
Szt2 A G 4: 118,383,965 M1704T probably benign Het
Tfcp2l1 C T 1: 118,652,923 Q116* probably null Het
Timm44 A G 8: 4,260,603 M383T possibly damaging Het
Tnpo2 G A 8: 85,045,317 probably null Het
Wdfy3 A G 5: 101,951,312 L290P probably damaging Het
Wdr59 A G 8: 111,451,077 F898L probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp879 A T 11: 50,833,528 C234S probably damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CGGACTGATTTGGACCCTAG -3'
(R):5'- CAGAAGTCCATCCTTGGTTGG -3'

Sequencing Primer
(F):5'- TAGGGTGCTCTCAAACACTG -3'
(R):5'- AAGTCCATCCTTGGTTGGGTTGG -3'
Posted On2014-08-01