Mutagenetix > Incidental Mutation

Incidental Mutation 'R1965:Pdzrn4'

218317

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

039978-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R1965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 92746309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably null
Transcript: ENSMUST00000035399

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169942

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229577

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	T	A	5: 98,346,234	D32E	probably damaging	Het
1700042G07Rik	G	A	4: 116,174,179	C82Y	probably damaging	Het
Aco1	T	G	4: 40,175,730	L157R	probably damaging	Het
Acot11	A	T	4: 106,749,353	L513Q	probably damaging	Het
Amd1	A	G	10: 40,294,759	I52T	probably benign	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arel1	T	A	12: 84,940,399		probably null	Het
Arg1	T	A	10: 24,916,864		probably null	Het
Atf1	A	T	15: 100,254,171	M135L	probably benign	Het
Atf2	T	C	2: 73,850,898	E77G	possibly damaging	Het
Axin1	G	T	17: 26,184,225	A394S	probably damaging	Het
Axin1	A	T	17: 26,190,228	Q734L	probably damaging	Het
Brd8	G	C	18: 34,602,766	A886G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Celf3	T	C	3: 94,485,327	V35A	probably damaging	Het
Ckap2	T	C	8: 22,175,787	T415A	possibly damaging	Het
Crybg3	T	C	16: 59,503,237	Y1066C	probably damaging	Het
Csmd3	T	C	15: 47,849,748	H1506R	probably benign	Het
Dnah10	A	G	5: 124,775,203	D1808G	probably damaging	Het
Dsc3	C	T	18: 19,980,672	G398R	probably damaging	Het
Emc2	A	G	15: 43,527,467	Q293R	probably damaging	Het
Evc2	A	G	5: 37,363,532	N251D	possibly damaging	Het
Fam151a	A	T	4: 106,733,915		probably benign	Het
Fam208a	T	G	14: 27,442,554	C272W	probably damaging	Het
Fbxw16	T	A	9: 109,441,221	I151F	probably damaging	Het
Fmnl2	A	G	2: 53,114,868	D658G	probably damaging	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Foxc2	T	A	8: 121,116,674	S20R	probably damaging	Het
Fpr-rs6	C	T	17: 20,182,656	G148R	probably damaging	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Fyb2	A	T	4: 104,913,649	I54F	probably benign	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gldc	G	A	19: 30,137,113	R466*	probably null	Het
Gm12695	T	A	4: 96,762,845	S124C	probably benign	Het
Gm4846	A	T	1: 166,486,964	I370N	possibly damaging	Het
Gsdmc3	T	C	15: 63,858,447	T423A	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcnmb3	T	C	3: 32,472,343	Y233C	probably damaging	Het
Kidins220	A	G	12: 24,994,906	D191G	probably damaging	Het
Kmt2a	A	G	9: 44,821,460		probably benign	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Myo1f	C	T	17: 33,598,172	R730*	probably null	Het
Ncoa7	C	A	10: 30,654,430	E30*	probably null	Het
Neurod4	T	A	10: 130,271,049	K119*	probably null	Het
Npy5r	T	C	8: 66,681,277	D288G	probably benign	Het
Nr3c2	A	T	8: 76,909,463	I398L	probably damaging	Het
Olfr1002	T	C	2: 85,647,746	T192A	possibly damaging	Het
Olfr1151	A	G	2: 87,857,415	K80R	probably benign	Het
Olfr1160	A	G	2: 88,006,304	F149S	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr1277	T	C	2: 111,269,593	Y258C	probably damaging	Het
Olfr533	C	A	7: 140,466,661	F153L	probably benign	Het
Olfr624	A	T	7: 103,670,896	I45N	probably damaging	Het
Olfr713	T	C	7: 107,036,358	S68P	probably damaging	Het
Pcf11	A	T	7: 92,661,601	M393K	probably benign	Het
Pck2	T	C	14: 55,542,507	V71A	probably benign	Het
Pdzd8	G	T	19: 59,300,122	L949I	probably benign	Het
Phospho1	A	G	11: 95,830,879	N125S	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Ppp1r1b	A	G	11: 98,355,363	E57G	probably damaging	Het
Prtg	T	G	9: 72,848,322	S269A	probably benign	Het
Rbbp5	T	A	1: 132,494,297	S312T	probably damaging	Het
Rbm11	T	A	16: 75,598,768		probably null	Het
Retreg1	A	G	15: 25,970,164	T139A	probably damaging	Het
Riok3	T	A	18: 12,136,962	H120Q	probably damaging	Het
Rln1	A	T	19: 29,334,595	M1K	probably null	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Sccpdh	C	T	1: 179,684,314	P117L	probably damaging	Het
Serac1	T	C	17: 6,048,999	K506E	possibly damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Slc1a2	T	A	2: 102,739,900	N174K	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Slc46a2	T	A	4: 59,914,249	S225C	probably damaging	Het
Smarcc2	G	A	10: 128,474,758	E419K	probably damaging	Het
Stkld1	T	A	2: 26,946,732		probably null	Het
Szt2	A	G	4: 118,383,965	M1704T	probably benign	Het
Tfcp2l1	C	T	1: 118,652,923	Q116*	probably null	Het
Timm44	A	G	8: 4,260,603	M383T	possibly damaging	Het
Tnpo2	G	A	8: 85,045,317		probably null	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Wdfy3	A	G	5: 101,951,312	L290P	probably damaging	Het
Wdr59	A	G	8: 111,451,077	F898L	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zfp879	A	T	11: 50,833,528	C234S	probably damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCCCTGTCATGAATCAATTGAG -3'
(R):5'- ATCAAAAGCCTCCTTCTGGAAG -3'

Sequencing Primer
(F):5'- CCCTGTCATGAATCAATTGAGAATTC -3'
(R):5'- CTGGAAGCTGTTTCTCAATAACTGTC -3'

Posted On

2014-08-01