Incidental Mutation 'R0134:Tsfm'
ID21832
Institutional Source Beutler Lab
Gene Symbol Tsfm
Ensembl Gene ENSMUSG00000040521
Gene NameTs translation elongation factor, mitochondrial
SynonymsEF-TS, 9430024O13Rik, 2310050B20Rik, EF-Tsmt
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0134 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127011572-127030840 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 127022929 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000040560] [ENSMUST00000120547] [ENSMUST00000129173] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000026500
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040560
SMART Domains Protein: ENSMUSP00000042134
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
Pfam:EF_TS 115 273 9.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120547
SMART Domains Protein: ENSMUSP00000113446
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 3.4e-10 PFAM
Pfam:EF_TS 101 192 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129173
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145476
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial translation elongation factor. The encoded protein is an enzyme that catalyzes the exchange of guanine nucleotides on the translation elongation factor Tu during the elongation step of mitchondrial protein translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-3 syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Tsfm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tsfm APN 10 127028442 nonsense probably null
IGL00910:Tsfm APN 10 127028359 intron probably benign
IGL01553:Tsfm APN 10 127028390 missense probably benign 0.01
R0123:Tsfm UTSW 10 127022929 intron probably benign
R0129:Tsfm UTSW 10 127030470 missense probably benign 0.28
R1689:Tsfm UTSW 10 127028455 missense probably damaging 1.00
R2004:Tsfm UTSW 10 127030794 missense probably damaging 1.00
R2144:Tsfm UTSW 10 127028445 nonsense probably null
R4574:Tsfm UTSW 10 127028373 missense probably damaging 0.99
R4690:Tsfm UTSW 10 127030678 intron probably benign
R5141:Tsfm UTSW 10 127029613 missense probably damaging 0.98
R5371:Tsfm UTSW 10 127011643 missense probably benign 0.03
R5801:Tsfm UTSW 10 127022837 frame shift probably null
R5949:Tsfm UTSW 10 127028375 missense probably damaging 1.00
R6959:Tsfm UTSW 10 127022909 missense probably benign 0.05
R7248:Tsfm UTSW 10 127011631 missense probably benign 0.31
R7499:Tsfm UTSW 10 127022548 missense possibly damaging 0.94
R7810:Tsfm UTSW 10 127011689 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTACTGCCCCAGTGTAATGGAAG -3'
(R):5'- TGAGTGACAGCCAGCCTGTTTTAG -3'

Sequencing Primer
(F):5'- AGGCTCATCGTCCAGGGAG -3'
(R):5'- CATCACGGTGCAGATAGACT -3'
Posted On2013-04-12