Mutagenetix > Incidental Mutations

Incidental Mutation 'R1965:Rln1'

218330

Institutional Source

Beutler Lab

Gene Symbol

Rln1

Ensembl Gene

ENSMUSG00000039097

Gene Name

relaxin 1

Synonyms

rlx

MMRRC Submission

039978-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1965 (G1)

Quality Score

178

Status

Not validated

Chromosome

Chromosomal Location

29331170-29334670 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to T at 29334595 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000043376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044143]

Predicted Effect

probably null
Transcript: ENSMUST00000044143
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043376
Gene: ENSMUSG00000039097
AA Change: M1K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IlGF	33	185	6.34e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182039

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
PHENOTYPE: Inactivation of this locus is compatible with fertility but not normal mammary gland development. Postpartum, homozygous mutant females exhibit slight nipples that are insufficient for suckling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	T	A	5: 98,346,234	D32E	probably damaging	Het
1700042G07Rik	G	A	4: 116,174,179	C82Y	probably damaging	Het
Aco1	T	G	4: 40,175,730	L157R	probably damaging	Het
Acot11	A	T	4: 106,749,353	L513Q	probably damaging	Het
Amd1	A	G	10: 40,294,759	I52T	probably benign	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arel1	T	A	12: 84,940,399		probably null	Het
Arg1	T	A	10: 24,916,864		probably null	Het
Atf1	A	T	15: 100,254,171	M135L	probably benign	Het
Atf2	T	C	2: 73,850,898	E77G	possibly damaging	Het
Axin1	G	T	17: 26,184,225	A394S	probably damaging	Het
Axin1	A	T	17: 26,190,228	Q734L	probably damaging	Het
Brd8	G	C	18: 34,602,766	A886G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Celf3	T	C	3: 94,485,327	V35A	probably damaging	Het
Ckap2	T	C	8: 22,175,787	T415A	possibly damaging	Het
Crybg3	T	C	16: 59,503,237	Y1066C	probably damaging	Het
Csmd3	T	C	15: 47,849,748	H1506R	probably benign	Het
Dnah10	A	G	5: 124,775,203	D1808G	probably damaging	Het
Dsc3	C	T	18: 19,980,672	G398R	probably damaging	Het
Emc2	A	G	15: 43,527,467	Q293R	probably damaging	Het
Evc2	A	G	5: 37,363,532	N251D	possibly damaging	Het
Fam151a	A	T	4: 106,733,915		probably benign	Het
Fam208a	T	G	14: 27,442,554	C272W	probably damaging	Het
Fbxw16	T	A	9: 109,441,221	I151F	probably damaging	Het
Fmnl2	A	G	2: 53,114,868	D658G	probably damaging	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Foxc2	T	A	8: 121,116,674	S20R	probably damaging	Het
Fpr-rs6	C	T	17: 20,182,656	G148R	probably damaging	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Fyb2	A	T	4: 104,913,649	I54F	probably benign	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gldc	G	A	19: 30,137,113	R466*	probably null	Het
Gm12695	T	A	4: 96,762,845	S124C	probably benign	Het
Gm4846	A	T	1: 166,486,964	I370N	possibly damaging	Het
Gsdmc3	T	C	15: 63,858,447	T423A	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcnmb3	T	C	3: 32,472,343	Y233C	probably damaging	Het
Kidins220	A	G	12: 24,994,906	D191G	probably damaging	Het
Kmt2a	A	G	9: 44,821,460		probably benign	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Myo1f	C	T	17: 33,598,172	R730*	probably null	Het
Ncoa7	C	A	10: 30,654,430	E30*	probably null	Het
Neurod4	T	A	10: 130,271,049	K119*	probably null	Het
Npy5r	T	C	8: 66,681,277	D288G	probably benign	Het
Nr3c2	A	T	8: 76,909,463	I398L	probably damaging	Het
Olfr1002	T	C	2: 85,647,746	T192A	possibly damaging	Het
Olfr1151	A	G	2: 87,857,415	K80R	probably benign	Het
Olfr1160	A	G	2: 88,006,304	F149S	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr1277	T	C	2: 111,269,593	Y258C	probably damaging	Het
Olfr533	C	A	7: 140,466,661	F153L	probably benign	Het
Olfr624	A	T	7: 103,670,896	I45N	probably damaging	Het
Olfr713	T	C	7: 107,036,358	S68P	probably damaging	Het
Pcf11	A	T	7: 92,661,601	M393K	probably benign	Het
Pck2	T	C	14: 55,542,507	V71A	probably benign	Het
Pdzd8	G	T	19: 59,300,122	L949I	probably benign	Het
Pdzrn4	G	A	15: 92,746,309		probably null	Het
Phospho1	A	G	11: 95,830,879	N125S	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Ppp1r1b	A	G	11: 98,355,363	E57G	probably damaging	Het
Prtg	T	G	9: 72,848,322	S269A	probably benign	Het
Rbbp5	T	A	1: 132,494,297	S312T	probably damaging	Het
Rbm11	T	A	16: 75,598,768		probably null	Het
Retreg1	A	G	15: 25,970,164	T139A	probably damaging	Het
Riok3	T	A	18: 12,136,962	H120Q	probably damaging	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Sccpdh	C	T	1: 179,684,314	P117L	probably damaging	Het
Serac1	T	C	17: 6,048,999	K506E	possibly damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Slc1a2	T	A	2: 102,739,900	N174K	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Slc46a2	T	A	4: 59,914,249	S225C	probably damaging	Het
Smarcc2	G	A	10: 128,474,758	E419K	probably damaging	Het
Stkld1	T	A	2: 26,946,732		probably null	Het
Szt2	A	G	4: 118,383,965	M1704T	probably benign	Het
Tfcp2l1	C	T	1: 118,652,923	Q116*	probably null	Het
Timm44	A	G	8: 4,260,603	M383T	possibly damaging	Het
Tnpo2	G	A	8: 85,045,317		probably null	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Wdfy3	A	G	5: 101,951,312	L290P	probably damaging	Het
Wdr59	A	G	8: 111,451,077	F898L	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zfp879	A	T	11: 50,833,528	C234S	probably damaging	Het

Other mutations in Rln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Rln1	APN	19	29332014	missense	possibly damaging	0.84
IGL01607:Rln1	APN	19	29331860	missense	probably benign	0.02
IGL02415:Rln1	APN	19	29334398	missense	probably damaging	0.97
R0184:Rln1	UTSW	19	29331936	nonsense	probably null
R1670:Rln1	UTSW	19	29332068	missense	possibly damaging	0.95
R4434:Rln1	UTSW	19	29334562	missense	possibly damaging	0.85
R4437:Rln1	UTSW	19	29334562	missense	possibly damaging	0.85
R4438:Rln1	UTSW	19	29334562	missense	possibly damaging	0.85
R5525:Rln1	UTSW	19	29334520	missense	probably benign	0.44
R6484:Rln1	UTSW	19	29334502	missense	probably benign
R6648:Rln1	UTSW	19	29332121	missense	probably benign	0.28
R7624:Rln1	UTSW	19	29332099	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGCCAATCTTCCCACGGAG -3'
(R):5'- ATGTGACTTAGTCCAGGGGC -3'

Sequencing Primer
(F):5'- AGGCCCCGCAGATTTTGATC -3'
(R):5'- ACTTAGTCCAGGGGCCATGC -3'

Posted On

2014-08-01