Mutagenetix > Incidental Mutations

Incidental Mutation 'R1965:Gbf1'

218334

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

MMRRC Submission

039978-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1965 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46271564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 999 (F999L)

Ref Sequence

ENSEMBL: ENSMUSP00000135062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]

AlphaFold

Q6DFZ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000026254
AA Change: F1053L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: F1053L

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176422

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176853

Predicted Effect

probably damaging
Transcript: ENSMUST00000176992
AA Change: F999L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: F999L

Domain	Start	End	E-Value	Type
low complexity region	216	234	N/A	INTRINSIC
Pfam:Sec7_N	343	498	1.5e-35	PFAM
Sec7	642	830	8.55e-91	SMART
low complexity region	1144	1162	N/A	INTRINSIC
low complexity region	1227	1242	N/A	INTRINSIC
low complexity region	1715	1735	N/A	INTRINSIC
low complexity region	1744	1762	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177406

Predicted Effect

probably benign
Transcript: ENSMUST00000177512

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	T	A	5: 98,346,234	D32E	probably damaging	Het
1700042G07Rik	G	A	4: 116,174,179	C82Y	probably damaging	Het
Aco1	T	G	4: 40,175,730	L157R	probably damaging	Het
Acot11	A	T	4: 106,749,353	L513Q	probably damaging	Het
Amd1	A	G	10: 40,294,759	I52T	probably benign	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arel1	T	A	12: 84,940,399		probably null	Het
Arg1	T	A	10: 24,916,864		probably null	Het
Atf1	A	T	15: 100,254,171	M135L	probably benign	Het
Atf2	T	C	2: 73,850,898	E77G	possibly damaging	Het
Axin1	G	T	17: 26,184,225	A394S	probably damaging	Het
Axin1	A	T	17: 26,190,228	Q734L	probably damaging	Het
Brd8	G	C	18: 34,602,766	A886G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Celf3	T	C	3: 94,485,327	V35A	probably damaging	Het
Ckap2	T	C	8: 22,175,787	T415A	possibly damaging	Het
Crybg3	T	C	16: 59,503,237	Y1066C	probably damaging	Het
Csmd3	T	C	15: 47,849,748	H1506R	probably benign	Het
Dnah10	A	G	5: 124,775,203	D1808G	probably damaging	Het
Dsc3	C	T	18: 19,980,672	G398R	probably damaging	Het
Emc2	A	G	15: 43,527,467	Q293R	probably damaging	Het
Evc2	A	G	5: 37,363,532	N251D	possibly damaging	Het
Fam151a	A	T	4: 106,733,915		probably benign	Het
Fam208a	T	G	14: 27,442,554	C272W	probably damaging	Het
Fbxw16	T	A	9: 109,441,221	I151F	probably damaging	Het
Fmnl2	A	G	2: 53,114,868	D658G	probably damaging	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Foxc2	T	A	8: 121,116,674	S20R	probably damaging	Het
Fpr-rs6	C	T	17: 20,182,656	G148R	probably damaging	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Fyb2	A	T	4: 104,913,649	I54F	probably benign	Het
Gldc	G	A	19: 30,137,113	R466*	probably null	Het
Gm12695	T	A	4: 96,762,845	S124C	probably benign	Het
Gm4846	A	T	1: 166,486,964	I370N	possibly damaging	Het
Gsdmc3	T	C	15: 63,858,447	T423A	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcnmb3	T	C	3: 32,472,343	Y233C	probably damaging	Het
Kidins220	A	G	12: 24,994,906	D191G	probably damaging	Het
Kmt2a	A	G	9: 44,821,460		probably benign	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Myo1f	C	T	17: 33,598,172	R730*	probably null	Het
Ncoa7	C	A	10: 30,654,430	E30*	probably null	Het
Neurod4	T	A	10: 130,271,049	K119*	probably null	Het
Npy5r	T	C	8: 66,681,277	D288G	probably benign	Het
Nr3c2	A	T	8: 76,909,463	I398L	probably damaging	Het
Olfr1002	T	C	2: 85,647,746	T192A	possibly damaging	Het
Olfr1151	A	G	2: 87,857,415	K80R	probably benign	Het
Olfr1160	A	G	2: 88,006,304	F149S	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr1277	T	C	2: 111,269,593	Y258C	probably damaging	Het
Olfr533	C	A	7: 140,466,661	F153L	probably benign	Het
Olfr624	A	T	7: 103,670,896	I45N	probably damaging	Het
Olfr713	T	C	7: 107,036,358	S68P	probably damaging	Het
Pcf11	A	T	7: 92,661,601	M393K	probably benign	Het
Pck2	T	C	14: 55,542,507	V71A	probably benign	Het
Pdzd8	G	T	19: 59,300,122	L949I	probably benign	Het
Pdzrn4	G	A	15: 92,746,309		probably null	Het
Phospho1	A	G	11: 95,830,879	N125S	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Ppp1r1b	A	G	11: 98,355,363	E57G	probably damaging	Het
Prtg	T	G	9: 72,848,322	S269A	probably benign	Het
Rbbp5	T	A	1: 132,494,297	S312T	probably damaging	Het
Rbm11	T	A	16: 75,598,768		probably null	Het
Retreg1	A	G	15: 25,970,164	T139A	probably damaging	Het
Riok3	T	A	18: 12,136,962	H120Q	probably damaging	Het
Rln1	A	T	19: 29,334,595	M1K	probably null	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Sccpdh	C	T	1: 179,684,314	P117L	probably damaging	Het
Serac1	T	C	17: 6,048,999	K506E	possibly damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Slc1a2	T	A	2: 102,739,900	N174K	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Slc46a2	T	A	4: 59,914,249	S225C	probably damaging	Het
Smarcc2	G	A	10: 128,474,758	E419K	probably damaging	Het
Stkld1	T	A	2: 26,946,732		probably null	Het
Szt2	A	G	4: 118,383,965	M1704T	probably benign	Het
Tfcp2l1	C	T	1: 118,652,923	Q116*	probably null	Het
Timm44	A	G	8: 4,260,603	M383T	possibly damaging	Het
Tnpo2	G	A	8: 85,045,317		probably null	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Wdfy3	A	G	5: 101,951,312	L290P	probably damaging	Het
Wdr59	A	G	8: 111,451,077	F898L	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zfp879	A	T	11: 50,833,528	C234S	probably damaging	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2177:Gbf1	UTSW	19	46265670	missense	probably benign
R2238:Gbf1	UTSW	19	46163618	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R2520:Gbf1	UTSW	19	46265367	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6310:Gbf1	UTSW	19	46280005	missense	probably damaging	0.96
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R7801:Gbf1	UTSW	19	46272643	missense	probably benign	0.03
R8241:Gbf1	UTSW	19	46246137	missense	probably damaging	1.00
R8716:Gbf1	UTSW	19	46284021	missense	probably damaging	1.00
R8851:Gbf1	UTSW	19	46268483	missense	probably damaging	1.00
R9424:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9435:Gbf1	UTSW	19	46279993	missense	probably benign	0.42
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TACTTGGCCAGGAAGCACAG -3'
(R):5'- GACCACTCAATGTCAGCCAG -3'

Sequencing Primer
(F):5'- TCAGTATTGAGACTCCAGGCC -3'
(R):5'- TCAATGTCAGCCAGCTTACAAAG -3'

Posted On

2014-08-01