Incidental Mutation 'R0720:Bbs7'
ID218337
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission 038902-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0720 (G1)
Quality Score37
Status Validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36592423 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 416 (D416G)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
Predicted Effect probably damaging
Transcript: ENSMUST00000040148
AA Change: D416G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108155
AA Change: D416G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108156
AA Change: D416G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Meta Mutation Damage Score 0.6902 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A G 17: 42,713,172 I136T probably damaging Het
Commd4 G T 9: 57,155,434 D179E probably benign Het
Cyp3a57 T C 5: 145,390,403 probably benign Het
Dnah5 A G 15: 28,313,861 N1941S probably null Het
Dynap T C 18: 70,240,984 D157G unknown Het
Eri3 T C 4: 117,553,045 probably null Het
Fam189a1 A G 7: 64,819,910 probably benign Het
Fbxo25 A G 8: 13,935,222 Y305C probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fxr2 A G 11: 69,639,415 D36G probably benign Het
Gas2l3 T C 10: 89,413,943 T438A probably benign Het
Gcm1 A T 9: 78,064,641 Y288F possibly damaging Het
Gm3164 C A 14: 4,442,719 S218R probably benign Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Htra3 T C 5: 35,654,109 I392M probably damaging Het
Kansl1l T C 1: 66,801,356 M262V possibly damaging Het
Lrrc47 T C 4: 154,019,887 probably null Het
Macf1 A T 4: 123,432,925 N4926K probably damaging Het
Mllt10 T C 2: 18,196,595 S631P probably benign Het
Nlrp14 A G 7: 107,182,013 H139R probably benign Het
Olfr1153 A T 2: 87,896,669 T157S probably benign Het
Olfr394 T A 11: 73,887,862 N170I probably benign Het
Ptger2 T C 14: 44,989,133 C57R probably benign Het
Rhot1 T C 11: 80,223,943 V59A probably damaging Het
Rmdn2 G A 17: 79,668,029 probably null Het
Rxfp2 G T 5: 150,044,119 K148N probably benign Het
Sec23a G A 12: 58,971,271 T623M probably damaging Het
Smcr8 T C 11: 60,778,443 L139P probably damaging Het
Spag6l A T 16: 16,767,096 probably benign Het
Taar1 T C 10: 23,921,073 I223T probably damaging Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnfsf18 A G 1: 161,503,587 Y102C possibly damaging Het
Tns1 A G 1: 73,925,581 L1297P probably benign Het
Txndc8 C T 4: 57,984,245 probably benign Het
Ubr5 T C 15: 37,972,991 N2622S probably damaging Het
Vmn2r99 T A 17: 19,379,043 F330I probably benign Het
Zdhhc2 T A 8: 40,472,907 probably null Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCTTCAAACCCTGGCAG -3'
(R):5'- TCAGAATGGCTCCATGATTAAAGCCC -3'

Sequencing Primer
(F):5'- TGGCAGCACTACAGATGTCAC -3'
(R):5'- caggaatggaaaggcagagg -3'
Posted On2014-08-01