Incidental Mutation 'R0720:Fbxo25'
ID218339
Institutional Source Beutler Lab
Gene Symbol Fbxo25
Ensembl Gene ENSMUSG00000038365
Gene NameF-box protein 25
Synonyms9130015I06Rik, Fbx25
MMRRC Submission 038902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R0720 (G1)
Quality Score76
Status Validated
Chromosome8
Chromosomal Location13907803-13940522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13935222 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 305 (Y305C)
Ref Sequence ENSEMBL: ENSMUSP00000147467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043520] [ENSMUST00000209913]
Predicted Effect probably damaging
Transcript: ENSMUST00000043520
AA Change: Y306C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039544
Gene: ENSMUSG00000038365
AA Change: Y306C

DomainStartEndE-ValueType
low complexity region 209 222 N/A INTRINSIC
Blast:FBOX 230 271 1e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209310
Predicted Effect probably damaging
Transcript: ENSMUST00000209913
AA Change: Y305C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210280
AA Change: Y169C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.3678 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A G 17: 42,713,172 I136T probably damaging Het
Bbs7 T C 3: 36,592,423 D416G probably damaging Het
Commd4 G T 9: 57,155,434 D179E probably benign Het
Cyp3a57 T C 5: 145,390,403 probably benign Het
Dnah5 A G 15: 28,313,861 N1941S probably null Het
Dynap T C 18: 70,240,984 D157G unknown Het
Eri3 T C 4: 117,553,045 probably null Het
Fam189a1 A G 7: 64,819,910 probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Fxr2 A G 11: 69,639,415 D36G probably benign Het
Gas2l3 T C 10: 89,413,943 T438A probably benign Het
Gcm1 A T 9: 78,064,641 Y288F possibly damaging Het
Gm3164 C A 14: 4,442,719 S218R probably benign Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Htra3 T C 5: 35,654,109 I392M probably damaging Het
Kansl1l T C 1: 66,801,356 M262V possibly damaging Het
Lrrc47 T C 4: 154,019,887 probably null Het
Macf1 A T 4: 123,432,925 N4926K probably damaging Het
Mllt10 T C 2: 18,196,595 S631P probably benign Het
Nlrp14 A G 7: 107,182,013 H139R probably benign Het
Olfr1153 A T 2: 87,896,669 T157S probably benign Het
Olfr394 T A 11: 73,887,862 N170I probably benign Het
Ptger2 T C 14: 44,989,133 C57R probably benign Het
Rhot1 T C 11: 80,223,943 V59A probably damaging Het
Rmdn2 G A 17: 79,668,029 probably null Het
Rxfp2 G T 5: 150,044,119 K148N probably benign Het
Sec23a G A 12: 58,971,271 T623M probably damaging Het
Smcr8 T C 11: 60,778,443 L139P probably damaging Het
Spag6l A T 16: 16,767,096 probably benign Het
Taar1 T C 10: 23,921,073 I223T probably damaging Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnfsf18 A G 1: 161,503,587 Y102C possibly damaging Het
Tns1 A G 1: 73,925,581 L1297P probably benign Het
Txndc8 C T 4: 57,984,245 probably benign Het
Ubr5 T C 15: 37,972,991 N2622S probably damaging Het
Vmn2r99 T A 17: 19,379,043 F330I probably benign Het
Zdhhc2 T A 8: 40,472,907 probably null Het
Other mutations in Fbxo25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Fbxo25 APN 8 13923922 unclassified probably benign
IGL03087:Fbxo25 APN 8 13924019 critical splice donor site probably null
IGL03112:Fbxo25 APN 8 13921034 missense probably benign 0.18
IGL03403:Fbxo25 APN 8 13929423 missense probably benign 0.00
R0755:Fbxo25 UTSW 8 13935219 missense probably benign 0.00
R1865:Fbxo25 UTSW 8 13935248 missense probably damaging 1.00
R2043:Fbxo25 UTSW 8 13921905 missense probably damaging 0.99
R4213:Fbxo25 UTSW 8 13939581 missense probably damaging 1.00
R4248:Fbxo25 UTSW 8 13939617 missense probably damaging 1.00
R5380:Fbxo25 UTSW 8 13921886 missense probably benign 0.10
R7450:Fbxo25 UTSW 8 13931235 missense probably benign 0.09
R8264:Fbxo25 UTSW 8 13929393 missense possibly damaging 0.89
R8409:Fbxo25 UTSW 8 13914999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGAACACCGCGATTTGCCTGAC -3'
(R):5'- CAGAACGCTTTCAGTAAGGTTCCCG -3'

Sequencing Primer
(F):5'- GCGATTTGCCTGACTTGTTC -3'
(R):5'- AGTAAGGTTCCCGTGGCG -3'
Posted On2014-08-01