Incidental Mutation 'R0134:Itgae'
ID21834
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73111342 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 91 (M91L)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
AA Change: M91L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: M91L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102537
AA Change: M91L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: M91L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 unclassified probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7943:Itgae UTSW 11 73120273 critical splice acceptor site probably null
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCAGTCATTTCTGAATCCCCATC -3'
(R):5'- AGGCTTGGCAGCTCCATAGTCATC -3'

Sequencing Primer
(F):5'- ATCCCTGGTTGTCAAGGC -3'
(R):5'- AGCTCCATAGTCATCCCCAG -3'
Posted On2013-04-12