Incidental Mutation 'R0707:Bpifb5'
ID218348
Institutional Source Beutler Lab
Gene Symbol Bpifb5
Ensembl Gene ENSMUSG00000038572
Gene NameBPI fold containing family B, member 5
SynonymsBC018465
MMRRC Submission 038890-MU
Accession Numbers

Genbank: NM_144890; MGI: 2385160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0707 (G1)
Quality Score56
Status Validated
Chromosome2
Chromosomal Location154223742-154240902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154228900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 204 (T204A)
Ref Sequence ENSEMBL: ENSMUSP00000046683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045959]
Predicted Effect probably benign
Transcript: ENSMUST00000045959
AA Change: T204A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046683
Gene: ENSMUSG00000038572
AA Change: T204A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
coiled coil region 26 54 N/A INTRINSIC
Pfam:LBP_BPI_CETP 94 231 7.6e-14 PFAM
Blast:BPI2 291 488 4e-91 BLAST
SCOP:d1ewfa2 433 486 8e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Ankrd24 A T 10: 81,642,713 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Ccr7 T A 11: 99,145,983 T38S probably damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cog6 C T 3: 53,013,862 V108I possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dnajc13 T C 9: 104,172,582 K1780R probably benign Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Herc6 G A 6: 57,662,362 G905E possibly damaging Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr467 A G 7: 107,815,124 D182G probably damaging Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Bpifb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Bpifb5 APN 2 154233249 missense possibly damaging 0.86
IGL01676:Bpifb5 APN 2 154229049 missense possibly damaging 0.71
IGL02065:Bpifb5 APN 2 154227183 missense probably damaging 0.98
IGL02141:Bpifb5 APN 2 154229557 splice site probably null
IGL02244:Bpifb5 APN 2 154225148 missense possibly damaging 0.93
IGL03118:Bpifb5 APN 2 154236753 splice site probably benign
A4554:Bpifb5 UTSW 2 154227180 missense possibly damaging 0.71
R0022:Bpifb5 UTSW 2 154230348 missense probably damaging 0.98
R0492:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0654:Bpifb5 UTSW 2 154228900 missense probably benign 0.11
R0692:Bpifb5 UTSW 2 154234696 missense probably benign 0.33
R0898:Bpifb5 UTSW 2 154233334 missense probably benign
R1534:Bpifb5 UTSW 2 154229499 missense possibly damaging 0.86
R1539:Bpifb5 UTSW 2 154223856 missense probably benign
R1874:Bpifb5 UTSW 2 154227202 splice site probably benign
R1971:Bpifb5 UTSW 2 154230344 missense probably benign 0.18
R2001:Bpifb5 UTSW 2 154233279 missense possibly damaging 0.53
R3013:Bpifb5 UTSW 2 154228855 missense possibly damaging 0.59
R3916:Bpifb5 UTSW 2 154228181 missense probably benign
R4499:Bpifb5 UTSW 2 154240758 missense possibly damaging 0.53
R5250:Bpifb5 UTSW 2 154224961 missense probably benign
R6301:Bpifb5 UTSW 2 154230219 missense possibly damaging 0.73
R6836:Bpifb5 UTSW 2 154228065 missense probably benign 0.02
R6869:Bpifb5 UTSW 2 154233223 missense probably benign 0.33
R7014:Bpifb5 UTSW 2 154224956 nonsense probably null
R7300:Bpifb5 UTSW 2 154228146 missense possibly damaging 0.85
R7427:Bpifb5 UTSW 2 154225122 missense probably benign
R7428:Bpifb5 UTSW 2 154225122 missense probably benign
R7439:Bpifb5 UTSW 2 154228933 missense possibly damaging 0.71
R7448:Bpifb5 UTSW 2 154230185 missense possibly damaging 0.53
T0975:Bpifb5 UTSW 2 154229464 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTTTTCCCCAGCGGTACTTG -3'
(R):5'- ATGGCTCCCTCTGTGAACTCTGTG -3'

Sequencing Primer
(F):5'- CCAGCGGTACTTGGCTTC -3'
(R):5'- ggctatccatcctgtccctg -3'
Posted On2014-08-01