Mutagenetix > Incidental Mutation

Incidental Mutation 'R0134:Arhgap23'

21835

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

038419-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0134 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 97444328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 70 (V70L)

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121799]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000121799
AA Change: V70L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: V70L

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152933

Meta Mutation Damage Score

0.0712

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Prickle1	A	G	15: 93,510,777	L47P	possibly damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0225:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0497:Arhgap23	UTSW	11	97452163	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3767:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7209:Arhgap23	UTSW	11	97492447	splice site	probably null
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R7599:Arhgap23	UTSW	11	97500343	missense	probably benign
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8332:Arhgap23	UTSW	11	97491134	missense	unknown
R8412:Arhgap23	UTSW	11	97466028	missense	probably benign	0.02
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
R8692:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R8708:Arhgap23	UTSW	11	97452412	missense	probably benign	0.06
R8749:Arhgap23	UTSW	11	97500815	missense	probably damaging	0.99
R8882:Arhgap23	UTSW	11	97465123	missense	probably benign	0.00
R9188:Arhgap23	UTSW	11	97500157	missense	possibly damaging	0.72
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGAGGAGAGAGGCTTTCTGC -3'
(R):5'- ACAGTCACAGAGCAAGTGTCCCAG -3'

Sequencing Primer
(F):5'- GTGGACCACACACTCTCTG -3'
(R):5'- TGGCACAGCCTCCTTACAG -3'

Posted On

2013-04-12