Incidental Mutation 'R0707:Cplane1'
ID 218360
Institutional Source Beutler Lab
Gene Symbol Cplane1
Ensembl Gene ENSMUSG00000039801
Gene Name ciliogenesis and planar polarity effector 1
Synonyms Hug, 2410089E03Rik, b2b012Clo, Jbts17
MMRRC Submission 038890-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0707 (G1)
Quality Score 36
Status Validated
Chromosome 15
Chromosomal Location 8198590-8300642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8287805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2881 (N2881K)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000110617
AA Change: N2881K
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: N2881K

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 A G 4: 106,617,329 (GRCm39) F259S probably damaging Het
Aldh16a1 T A 7: 44,793,931 (GRCm39) probably benign Het
Ankrd24 A T 10: 81,478,547 (GRCm39) probably benign Het
Arhgap5 T C 12: 52,564,951 (GRCm39) S641P probably damaging Het
Arpp21 A C 9: 111,986,824 (GRCm39) S242R probably benign Het
Bpifb5 A G 2: 154,070,820 (GRCm39) T204A probably benign Het
Bud31 A G 5: 145,083,265 (GRCm39) Y77C probably damaging Het
Ccdc65 G A 15: 98,607,095 (GRCm39) V101I possibly damaging Het
Ccr7 T A 11: 99,036,809 (GRCm39) T38S probably damaging Het
Cdc14a T C 3: 116,087,362 (GRCm39) probably benign Het
Ces2f C T 8: 105,677,618 (GRCm39) H208Y possibly damaging Het
Chst1 C A 2: 92,443,964 (GRCm39) N145K possibly damaging Het
Clock A G 5: 76,374,976 (GRCm39) V731A possibly damaging Het
Cog6 C T 3: 52,921,283 (GRCm39) V108I possibly damaging Het
Crtc2 T A 3: 90,170,804 (GRCm39) F626I probably damaging Het
Dicer1 A T 12: 104,673,144 (GRCm39) F792I probably damaging Het
Dnajc13 T C 9: 104,049,781 (GRCm39) K1780R probably benign Het
Dph5 A C 3: 115,708,782 (GRCm39) N155H probably benign Het
Dscam T C 16: 96,626,982 (GRCm39) probably null Het
Etl4 C A 2: 20,810,382 (GRCm39) probably benign Het
Flt3l T C 7: 44,785,450 (GRCm39) S9G probably benign Het
Fmnl2 A G 2: 52,944,498 (GRCm39) E159G possibly damaging Het
Fryl A G 5: 73,240,715 (GRCm39) I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gatad2b T A 3: 90,263,489 (GRCm39) S529T probably benign Het
Herc6 G A 6: 57,639,347 (GRCm39) G905E possibly damaging Het
Hhip T A 8: 80,724,884 (GRCm39) N296I probably damaging Het
Hmgcr A T 13: 96,787,151 (GRCm39) probably benign Het
Kalrn T G 16: 33,830,951 (GRCm39) N723H possibly damaging Het
Mroh5 T A 15: 73,662,588 (GRCm39) Y242F possibly damaging Het
Msh3 T A 13: 92,483,848 (GRCm39) K258* probably null Het
Myo1a T C 10: 127,555,732 (GRCm39) probably benign Het
Nlrp4f C T 13: 65,342,317 (GRCm39) E443K probably benign Het
Nupr2 A G 5: 129,937,533 (GRCm39) Y34C probably damaging Het
Ociad1 T C 5: 73,452,255 (GRCm39) probably benign Het
Or1af1 A T 2: 37,110,208 (GRCm39) K236* probably null Het
Or5af2 T A 11: 58,708,577 (GRCm39) L248M probably damaging Het
Or5b3 A T 19: 13,388,784 (GRCm39) M284L probably benign Het
Or5p5 A G 7: 107,414,331 (GRCm39) D182G probably damaging Het
Or6ae1 T C 7: 139,742,002 (GRCm39) N287S probably damaging Het
P2ry12 C A 3: 59,124,908 (GRCm39) V256F probably damaging Het
Pcdhb22 T A 18: 37,651,904 (GRCm39) I124N probably damaging Het
Pcnt A G 10: 76,256,375 (GRCm39) F622L probably damaging Het
Pfas A T 11: 68,888,863 (GRCm39) N361K probably benign Het
Plod2 T G 9: 92,487,480 (GRCm39) L600V possibly damaging Het
Pole T C 5: 110,446,854 (GRCm39) Y631H probably damaging Het
Proser1 T C 3: 53,386,197 (GRCm39) L693P probably damaging Het
Ptprd A G 4: 75,875,476 (GRCm39) Y1195H probably damaging Het
Rbm27 T A 18: 42,459,091 (GRCm39) probably null Het
Ric8a A G 7: 140,437,886 (GRCm39) probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rimkla C T 4: 119,335,177 (GRCm39) V69M probably damaging Het
Scfd1 A T 12: 51,459,360 (GRCm39) K307M probably damaging Het
Sh2b2 A G 5: 136,261,117 (GRCm39) F33S probably damaging Het
Smg7 T G 1: 152,746,508 (GRCm39) probably null Het
Srebf1 T C 11: 60,094,942 (GRCm39) T486A probably benign Het
Strn3 G A 12: 51,657,187 (GRCm39) T642I probably damaging Het
Syne2 T C 12: 76,028,837 (GRCm39) probably null Het
Syne3 A G 12: 104,935,619 (GRCm39) L53P probably damaging Het
Tcea1 T A 1: 4,950,569 (GRCm39) probably benign Het
Tmem30b T C 12: 73,592,942 (GRCm39) N58D probably benign Het
Tnpo1 A G 13: 98,991,954 (GRCm39) Y641H probably damaging Het
Trim25 A T 11: 88,890,564 (GRCm39) T84S probably benign Het
Trip4 A T 9: 65,746,286 (GRCm39) F537I possibly damaging Het
Uaca G A 9: 60,755,900 (GRCm39) probably benign Het
Ugt2b34 T A 5: 87,040,758 (GRCm39) Y388F possibly damaging Het
Vmn2r71 T C 7: 85,268,640 (GRCm39) V281A probably benign Het
Vps13d A T 4: 144,882,502 (GRCm39) D1030E probably damaging Het
Vps8 C A 16: 21,261,107 (GRCm39) F82L probably damaging Het
Zfp296 A G 7: 19,313,661 (GRCm39) D172G probably benign Het
Zfp977 C A 7: 42,229,958 (GRCm39) C189F probably damaging Het
Other mutations in Cplane1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Cplane1 APN 15 8,293,931 (GRCm39) splice site probably benign
IGL00766:Cplane1 APN 15 8,281,648 (GRCm39) missense unknown
IGL01483:Cplane1 APN 15 8,216,591 (GRCm39) missense probably damaging 0.98
IGL01520:Cplane1 APN 15 8,251,395 (GRCm39) missense probably damaging 0.96
IGL01578:Cplane1 APN 15 8,300,194 (GRCm39) missense unknown
IGL01701:Cplane1 APN 15 8,232,741 (GRCm39) splice site probably benign
IGL01892:Cplane1 APN 15 8,271,749 (GRCm39) splice site probably benign
IGL01895:Cplane1 APN 15 8,258,591 (GRCm39) missense possibly damaging 0.63
IGL01922:Cplane1 APN 15 8,300,305 (GRCm39) missense unknown
IGL01978:Cplane1 APN 15 8,248,866 (GRCm39) missense probably damaging 0.98
IGL02031:Cplane1 APN 15 8,209,253 (GRCm39) missense probably damaging 0.99
IGL02318:Cplane1 APN 15 8,204,509 (GRCm39) missense probably damaging 0.98
IGL02321:Cplane1 APN 15 8,246,056 (GRCm39) missense probably benign 0.04
IGL02363:Cplane1 APN 15 8,247,921 (GRCm39) missense possibly damaging 0.68
IGL02404:Cplane1 APN 15 8,216,768 (GRCm39) missense possibly damaging 0.48
IGL02535:Cplane1 APN 15 8,204,322 (GRCm39) missense probably damaging 1.00
IGL02732:Cplane1 APN 15 8,209,375 (GRCm39) missense probably benign 0.03
IGL02895:Cplane1 APN 15 8,261,591 (GRCm39) splice site probably benign
IGL02903:Cplane1 APN 15 8,299,262 (GRCm39) missense unknown
IGL02903:Cplane1 APN 15 8,299,263 (GRCm39) missense unknown
IGL02979:Cplane1 APN 15 8,248,038 (GRCm39) missense possibly damaging 0.82
IGL03077:Cplane1 APN 15 8,242,279 (GRCm39) splice site probably benign
IGL03196:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
IGL03344:Cplane1 APN 15 8,216,942 (GRCm39) missense possibly damaging 0.63
IGL03368:Cplane1 APN 15 8,251,857 (GRCm39) missense probably benign 0.06
IGL03403:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
agnes UTSW 15 8,276,422 (GRCm39) nonsense probably null
dei UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0101:Cplane1 UTSW 15 8,250,444 (GRCm39) missense probably benign 0.00
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0165:Cplane1 UTSW 15 8,245,866 (GRCm39) missense probably damaging 1.00
R0306:Cplane1 UTSW 15 8,209,373 (GRCm39) missense probably damaging 1.00
R0433:Cplane1 UTSW 15 8,246,046 (GRCm39) missense probably benign 0.00
R0491:Cplane1 UTSW 15 8,211,727 (GRCm39) missense probably damaging 1.00
R0523:Cplane1 UTSW 15 8,223,870 (GRCm39) missense probably damaging 1.00
R0571:Cplane1 UTSW 15 8,289,277 (GRCm39) missense unknown
R0679:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R0704:Cplane1 UTSW 15 8,239,567 (GRCm39) missense possibly damaging 0.93
R0715:Cplane1 UTSW 15 8,252,576 (GRCm39) missense probably benign 0.14
R0762:Cplane1 UTSW 15 8,247,900 (GRCm39) unclassified probably benign
R0830:Cplane1 UTSW 15 8,276,669 (GRCm39) missense unknown
R0924:Cplane1 UTSW 15 8,280,554 (GRCm39) splice site probably benign
R1071:Cplane1 UTSW 15 8,247,910 (GRCm39) missense probably benign 0.20
R1184:Cplane1 UTSW 15 8,245,971 (GRCm39) missense probably benign
R1224:Cplane1 UTSW 15 8,207,869 (GRCm39) missense probably benign 0.06
R1416:Cplane1 UTSW 15 8,276,422 (GRCm39) nonsense probably null
R1428:Cplane1 UTSW 15 8,248,853 (GRCm39) missense possibly damaging 0.83
R1487:Cplane1 UTSW 15 8,215,715 (GRCm39) missense probably damaging 1.00
R1641:Cplane1 UTSW 15 8,258,443 (GRCm39) missense probably benign 0.41
R1652:Cplane1 UTSW 15 8,230,630 (GRCm39) missense probably damaging 1.00
R1688:Cplane1 UTSW 15 8,258,093 (GRCm39) missense probably benign 0.00
R1715:Cplane1 UTSW 15 8,256,384 (GRCm39) splice site probably null
R1820:Cplane1 UTSW 15 8,299,129 (GRCm39) missense unknown
R1863:Cplane1 UTSW 15 8,258,077 (GRCm39) missense probably benign 0.00
R1940:Cplane1 UTSW 15 8,263,336 (GRCm39) missense probably damaging 0.98
R1967:Cplane1 UTSW 15 8,232,904 (GRCm39) missense probably benign 0.09
R2064:Cplane1 UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R2076:Cplane1 UTSW 15 8,248,741 (GRCm39) missense possibly damaging 0.93
R2163:Cplane1 UTSW 15 8,232,735 (GRCm39) splice site probably null
R2208:Cplane1 UTSW 15 8,223,887 (GRCm39) missense probably benign 0.33
R2504:Cplane1 UTSW 15 8,248,700 (GRCm39) missense probably damaging 0.99
R2568:Cplane1 UTSW 15 8,230,753 (GRCm39) missense possibly damaging 0.70
R2845:Cplane1 UTSW 15 8,245,864 (GRCm39) missense probably damaging 1.00
R2913:Cplane1 UTSW 15 8,300,169 (GRCm39) missense unknown
R3056:Cplane1 UTSW 15 8,280,491 (GRCm39) missense unknown
R3706:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3707:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3870:Cplane1 UTSW 15 8,247,948 (GRCm39) missense probably damaging 0.98
R3877:Cplane1 UTSW 15 8,251,427 (GRCm39) missense probably benign
R3886:Cplane1 UTSW 15 8,201,289 (GRCm39) missense probably damaging 0.98
R4057:Cplane1 UTSW 15 8,248,509 (GRCm39) missense probably benign 0.08
R4090:Cplane1 UTSW 15 8,241,842 (GRCm39) splice site probably null
R4362:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4363:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4445:Cplane1 UTSW 15 8,281,672 (GRCm39) missense unknown
R4581:Cplane1 UTSW 15 8,201,282 (GRCm39) missense possibly damaging 0.85
R4587:Cplane1 UTSW 15 8,230,636 (GRCm39) missense possibly damaging 0.50
R4659:Cplane1 UTSW 15 8,245,760 (GRCm39) intron probably benign
R4663:Cplane1 UTSW 15 8,247,939 (GRCm39) missense probably benign 0.31
R4779:Cplane1 UTSW 15 8,248,322 (GRCm39) missense probably benign 0.04
R4812:Cplane1 UTSW 15 8,230,607 (GRCm39) splice site probably null
R4850:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R4896:Cplane1 UTSW 15 8,251,421 (GRCm39) missense probably benign 0.00
R5273:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R5273:Cplane1 UTSW 15 8,273,825 (GRCm39) missense probably damaging 0.98
R5303:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5307:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5308:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5373:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5374:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5386:Cplane1 UTSW 15 8,223,897 (GRCm39) missense probably damaging 1.00
R5534:Cplane1 UTSW 15 8,258,319 (GRCm39) missense probably benign 0.06
R5720:Cplane1 UTSW 15 8,233,171 (GRCm39) missense probably benign 0.35
R5891:Cplane1 UTSW 15 8,218,073 (GRCm39) missense probably benign 0.00
R5932:Cplane1 UTSW 15 8,274,079 (GRCm39) splice site probably null
R6053:Cplane1 UTSW 15 8,217,945 (GRCm39) missense probably benign 0.35
R6166:Cplane1 UTSW 15 8,216,044 (GRCm39) missense probably benign 0.00
R6245:Cplane1 UTSW 15 8,207,902 (GRCm39) missense probably benign 0.01
R6246:Cplane1 UTSW 15 8,239,498 (GRCm39) missense probably damaging 1.00
R6541:Cplane1 UTSW 15 8,248,779 (GRCm39) missense possibly damaging 0.48
R6622:Cplane1 UTSW 15 8,273,706 (GRCm39) missense probably damaging 0.98
R6707:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R6729:Cplane1 UTSW 15 8,218,085 (GRCm39) splice site probably null
R6805:Cplane1 UTSW 15 8,273,790 (GRCm39) missense probably benign 0.07
R6806:Cplane1 UTSW 15 8,216,342 (GRCm39) missense possibly damaging 0.55
R6813:Cplane1 UTSW 15 8,258,766 (GRCm39) missense probably benign
R6830:Cplane1 UTSW 15 8,205,668 (GRCm39) missense probably benign 0.04
R6845:Cplane1 UTSW 15 8,251,388 (GRCm39) missense possibly damaging 0.84
R6894:Cplane1 UTSW 15 8,216,852 (GRCm39) missense probably damaging 0.99
R6970:Cplane1 UTSW 15 8,217,032 (GRCm39) missense probably benign 0.01
R6991:Cplane1 UTSW 15 8,281,690 (GRCm39) missense unknown
R7003:Cplane1 UTSW 15 8,258,246 (GRCm39) missense probably damaging 0.99
R7088:Cplane1 UTSW 15 8,248,431 (GRCm39) missense probably benign 0.16
R7104:Cplane1 UTSW 15 8,223,928 (GRCm39) missense possibly damaging 0.83
R7311:Cplane1 UTSW 15 8,210,399 (GRCm39) missense probably damaging 1.00
R7374:Cplane1 UTSW 15 8,276,731 (GRCm39) missense unknown
R7446:Cplane1 UTSW 15 8,261,564 (GRCm39) missense probably damaging 0.98
R7539:Cplane1 UTSW 15 8,230,728 (GRCm39) missense probably benign 0.19
R7543:Cplane1 UTSW 15 8,254,876 (GRCm39) missense unknown
R7558:Cplane1 UTSW 15 8,254,851 (GRCm39) missense unknown
R7629:Cplane1 UTSW 15 8,256,551 (GRCm39) nonsense probably null
R7635:Cplane1 UTSW 15 8,256,404 (GRCm39) missense probably benign 0.01
R7644:Cplane1 UTSW 15 8,252,611 (GRCm39) missense probably benign 0.00
R7705:Cplane1 UTSW 15 8,211,736 (GRCm39) missense probably damaging 1.00
R7752:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7754:Cplane1 UTSW 15 8,273,310 (GRCm39) missense possibly damaging 0.53
R7757:Cplane1 UTSW 15 8,281,711 (GRCm39) missense unknown
R7836:Cplane1 UTSW 15 8,233,241 (GRCm39) missense probably damaging 0.97
R7875:Cplane1 UTSW 15 8,239,446 (GRCm39) missense probably benign 0.18
R7901:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7983:Cplane1 UTSW 15 8,251,299 (GRCm39) missense probably benign 0.01
R8030:Cplane1 UTSW 15 8,259,787 (GRCm39) missense probably damaging 1.00
R8088:Cplane1 UTSW 15 8,215,802 (GRCm39) missense probably benign 0.00
R8231:Cplane1 UTSW 15 8,248,511 (GRCm39) missense probably benign 0.16
R8443:Cplane1 UTSW 15 8,230,635 (GRCm39) missense probably benign 0.03
R8480:Cplane1 UTSW 15 8,216,942 (GRCm39) missense possibly damaging 0.63
R8693:Cplane1 UTSW 15 8,258,492 (GRCm39) missense probably benign 0.15
R8785:Cplane1 UTSW 15 8,204,244 (GRCm39) missense probably benign 0.39
R8791:Cplane1 UTSW 15 8,216,744 (GRCm39) missense probably damaging 1.00
R8822:Cplane1 UTSW 15 8,201,262 (GRCm39) missense probably damaging 1.00
R8831:Cplane1 UTSW 15 8,211,620 (GRCm39) missense probably benign 0.09
R8932:Cplane1 UTSW 15 8,223,859 (GRCm39) missense probably damaging 1.00
R8968:Cplane1 UTSW 15 8,230,765 (GRCm39) missense possibly damaging 0.84
R8973:Cplane1 UTSW 15 8,233,277 (GRCm39) missense probably damaging 1.00
R9036:Cplane1 UTSW 15 8,252,622 (GRCm39) missense possibly damaging 0.63
R9134:Cplane1 UTSW 15 8,228,716 (GRCm39) missense probably damaging 0.99
R9197:Cplane1 UTSW 15 8,280,536 (GRCm39) missense unknown
R9259:Cplane1 UTSW 15 8,232,787 (GRCm39) missense possibly damaging 0.82
R9269:Cplane1 UTSW 15 8,248,500 (GRCm39) missense probably damaging 0.97
R9294:Cplane1 UTSW 15 8,232,811 (GRCm39) missense probably benign 0.00
R9328:Cplane1 UTSW 15 8,215,692 (GRCm39) missense probably damaging 1.00
R9563:Cplane1 UTSW 15 8,216,563 (GRCm39) missense probably benign 0.20
R9680:Cplane1 UTSW 15 8,231,785 (GRCm39) missense possibly damaging 0.68
R9721:Cplane1 UTSW 15 8,254,893 (GRCm39) missense unknown
R9779:Cplane1 UTSW 15 8,230,786 (GRCm39) missense possibly damaging 0.93
R9780:Cplane1 UTSW 15 8,258,123 (GRCm39) missense probably benign 0.00
U24488:Cplane1 UTSW 15 8,211,694 (GRCm39) missense probably damaging 1.00
X0023:Cplane1 UTSW 15 8,276,515 (GRCm39) missense unknown
Z1177:Cplane1 UTSW 15 8,239,473 (GRCm39) missense probably damaging 0.98
Z1177:Cplane1 UTSW 15 8,204,456 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCGAGAAACCTCGTCTCATAAAGTAA -3'
(R):5'- acAAGGACTATGGATCTGAACTGCTGT -3'

Sequencing Primer
(F):5'- CCTCGTCTCATAAAGTAAGTAGGG -3'
(R):5'- GGATCTGAACTGCTGTATCTTAACAC -3'
Posted On 2014-08-01