Incidental Mutation 'R0725:Nfyc'
ID218370
Institutional Source Beutler Lab
Gene Symbol Nfyc
Ensembl Gene ENSMUSG00000032897
Gene Namenuclear transcription factor-Y gamma
Synonyms
MMRRC Submission 038907-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0725 (G1)
Quality Score80
Status Validated
Chromosome4
Chromosomal Location120757438-120831572 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 120768734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043429] [ENSMUST00000097906] [ENSMUST00000118902] [ENSMUST00000120779] [ENSMUST00000134979] [ENSMUST00000136236]
Predicted Effect unknown
Transcript: ENSMUST00000043429
AA Change: Q185K
SMART Domains Protein: ENSMUSP00000047441
Gene: ENSMUSG00000032897
AA Change: Q185K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083556
Predicted Effect unknown
Transcript: ENSMUST00000097906
AA Change: Q185K
SMART Domains Protein: ENSMUSP00000095516
Gene: ENSMUSG00000032897
AA Change: Q185K

DomainStartEndE-ValueType
Pfam:Histone 9 107 7.2e-17 PFAM
Pfam:CBFD_NFYB_HMF 41 105 7.8e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118902
AA Change: Q185K
SMART Domains Protein: ENSMUSP00000112610
Gene: ENSMUSG00000032897
AA Change: Q185K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120779
AA Change: Q185K
SMART Domains Protein: ENSMUSP00000112810
Gene: ENSMUSG00000032897
AA Change: Q185K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134979
AA Change: Q123K
SMART Domains Protein: ENSMUSP00000114640
Gene: ENSMUSG00000032897
AA Change: Q123K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:1N1J|B 23 58 8e-9 PDB
low complexity region 88 128 N/A INTRINSIC
low complexity region 132 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136236
SMART Domains Protein: ENSMUSP00000117646
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:CBFD_NFYB_HMF 41 70 5.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196073
Meta Mutation Damage Score 0.1287 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Clptm1l A G 13: 73,606,343 T129A probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Cyp4b1 T C 4: 115,626,827 D395G probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dock7 T C 4: 98,945,291 D1891G probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Heatr5b T A 17: 78,796,396 I1117F probably benign Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Pkp1 G T 1: 135,880,740 N496K probably benign Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Vezf1 T C 11: 88,073,330 S103P probably benign Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Nfyc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Nfyc APN 4 120781547 intron probably benign
IGL01522:Nfyc APN 4 120781524 missense probably damaging 1.00
IGL01673:Nfyc APN 4 120779110 unclassified probably benign
IGL03197:Nfyc APN 4 120773761 missense probably damaging 1.00
PIT4378001:Nfyc UTSW 4 120790491 critical splice acceptor site probably null
R0638:Nfyc UTSW 4 120768884 missense probably benign 0.19
R0842:Nfyc UTSW 4 120759377 missense probably benign 0.16
R1480:Nfyc UTSW 4 120768724 critical splice donor site probably null
R1535:Nfyc UTSW 4 120761724 missense probably damaging 0.99
R1940:Nfyc UTSW 4 120773664 splice site probably benign
R3753:Nfyc UTSW 4 120765330 unclassified probably benign
R5605:Nfyc UTSW 4 120790489 splice site probably benign
R6047:Nfyc UTSW 4 120779117 splice site probably null
R7545:Nfyc UTSW 4 120773769 critical splice acceptor site probably null
Z1176:Nfyc UTSW 4 120790487 splice site probably benign
Z1177:Nfyc UTSW 4 120790466 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAGTCCTGGCATAGACAAGTAGC -3'
(R):5'- AGGCAACTGCACATAGCCTGTTTC -3'

Sequencing Primer
(F):5'- catcttgtccactgcactttc -3'
(R):5'- CACATAGCCTGTTTCAGGGAAG -3'
Posted On2014-08-01