Incidental Mutation 'R0134:Pnp2'
Institutional Source Beutler Lab
Gene Symbol Pnp2
Ensembl Gene ENSMUSG00000068417
Gene Namepurine-nucleoside phosphorylase 2
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location50955992-50964749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50963177 bp
Amino Acid Change Phenylalanine to Serine at position 100 (F100S)
Ref Sequence ENSEMBL: ENSMUSP00000093615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095925] [ENSMUST00000178092] [ENSMUST00000227052]
Predicted Effect probably damaging
Transcript: ENSMUST00000095925
AA Change: F100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093615
Gene: ENSMUSG00000068417
AA Change: F100S

Pfam:PNP_UDP_1 41 295 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178092
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338

Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228593
Meta Mutation Damage Score 0.9693 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Pnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Pnp2 APN 14 50959553 missense probably damaging 1.00
IGL02418:Pnp2 APN 14 50963836 missense possibly damaging 0.51
IGL03216:Pnp2 APN 14 50963197 missense probably benign 0.01
IGL03388:Pnp2 APN 14 50963538 missense probably damaging 1.00
R0049:Pnp2 UTSW 14 50959533 nonsense probably null
R0097:Pnp2 UTSW 14 50963501 missense probably benign 0.08
R0123:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0158:Pnp2 UTSW 14 50964304 missense probably damaging 1.00
R1477:Pnp2 UTSW 14 50959535 missense probably benign 0.35
R1820:Pnp2 UTSW 14 50964457 missense possibly damaging 0.93
R1934:Pnp2 UTSW 14 50956218 missense probably benign
R2138:Pnp2 UTSW 14 50963704 missense probably damaging 1.00
R3843:Pnp2 UTSW 14 50963421 missense probably null 1.00
R4355:Pnp2 UTSW 14 50959625 missense probably benign
R4938:Pnp2 UTSW 14 50963568 splice site probably null
R5516:Pnp2 UTSW 14 50963738 missense probably benign 0.33
R5636:Pnp2 UTSW 14 50956192 intron probably null
R6396:Pnp2 UTSW 14 50963159 missense probably damaging 1.00
R7117:Pnp2 UTSW 14 50964474 makesense probably null
R7862:Pnp2 UTSW 14 50963559 missense possibly damaging 0.95
R7934:Pnp2 UTSW 14 50964446 missense probably benign 0.00
R8057:Pnp2 UTSW 14 50964381 missense probably benign 0.06
R8104:Pnp2 UTSW 14 50959642 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctttttgtagcagtctcgcc -3'
Posted On2013-04-12