Incidental Mutation 'R0725:Clptm1l'
ID 218383
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene Name CLPTM1-like
Synonyms C130052I12Rik
MMRRC Submission 038907-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0725 (G1)
Quality Score 61
Status Validated
Chromosome 13
Chromosomal Location 73604006-73620605 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73606343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
AlphaFold Q8BXA5
Predicted Effect probably benign
Transcript: ENSMUST00000022102
AA Change: T129A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: T129A

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Cyp4b1 T C 4: 115,626,827 D395G probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dock7 T C 4: 98,945,291 D1891G probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Heatr5b T A 17: 78,796,396 I1117F probably benign Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Nfyc G T 4: 120,768,734 probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Pkp1 G T 1: 135,880,740 N496K probably benign Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Vezf1 T C 11: 88,073,330 S103P probably benign Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73607873 splice site probably null
IGL01963:Clptm1l APN 13 73617569 splice site probably benign
IGL02169:Clptm1l APN 13 73611663 missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73607760 missense probably benign 0.07
IGL02596:Clptm1l APN 13 73613666 missense probably benign 0.02
IGL02720:Clptm1l APN 13 73614602 splice site probably benign
IGL03100:Clptm1l APN 13 73612390 splice site probably benign
P0023:Clptm1l UTSW 13 73604952 missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73611667 missense possibly damaging 0.67
R1572:Clptm1l UTSW 13 73607747 missense probably benign
R1589:Clptm1l UTSW 13 73614673 critical splice donor site probably null
R2062:Clptm1l UTSW 13 73607723 nonsense probably null
R2064:Clptm1l UTSW 13 73607723 nonsense probably null
R2065:Clptm1l UTSW 13 73607723 nonsense probably null
R2067:Clptm1l UTSW 13 73607723 nonsense probably null
R2068:Clptm1l UTSW 13 73607723 nonsense probably null
R3003:Clptm1l UTSW 13 73617756 missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73616038 missense probably benign 0.21
R3808:Clptm1l UTSW 13 73612454 missense probably benign 0.13
R3966:Clptm1l UTSW 13 73615972 missense probably damaging 1.00
R4615:Clptm1l UTSW 13 73607738 nonsense probably null
R4801:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73611196 missense possibly damaging 0.52
R4957:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R5864:Clptm1l UTSW 13 73606284 missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73617765 critical splice donor site probably null
R6701:Clptm1l UTSW 13 73608906 missense probably benign 0.00
R6720:Clptm1l UTSW 13 73618516 missense probably damaging 1.00
R7782:Clptm1l UTSW 13 73604320 missense probably damaging 1.00
R8292:Clptm1l UTSW 13 73617735 missense probably damaging 0.96
R8329:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R9224:Clptm1l UTSW 13 73604225 start gained probably benign
R9528:Clptm1l UTSW 13 73612431 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGTCACAAGGCAGGTGGGTTTC -3'
(R):5'- ACGCTGAAGAATAACTGCCCTTCC -3'

Sequencing Primer
(F):5'- gctggggcaggaagaac -3'
(R):5'- AGTCTGCCTAGAGTGCTATGAATC -3'
Posted On 2014-08-01