Mutagenetix > Incidental Mutations

Incidental Mutation 'R0045:Stk35'

218392

Institutional Source

Beutler Lab

Gene Symbol

Stk35

Ensembl Gene

ENSMUSG00000037885

Gene Name

serine/threonine kinase 35

Synonyms

1700054C12Rik, CLIK1, CLP-36 interacting kinase

MMRRC Submission

038339-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0045 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

129800517-129832287 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 129800568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 10 (R10*)

Ref Sequence

ENSEMBL: ENSMUSP00000132862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]

AlphaFold

Q80ZW0

Predicted Effect

probably null
Transcript: ENSMUST00000165413
AA Change: R10*

SMART Domains

Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: R10*

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	295	2e-6	PFAM
Pfam:Pkinase	207	531	8.6e-51	PFAM
Pfam:Pkinase_Tyr	304	532	2.1e-23	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000166282
AA Change: R10*

SMART Domains

Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885
AA Change: R10*

Domain	Start	End	E-Value	Type
low complexity region	51	69	N/A	INTRINSIC
low complexity region	115	137	N/A	INTRINSIC
low complexity region	190	206	N/A	INTRINSIC
Pfam:Pkinase_Tyr	207	300	5.9e-7	PFAM
Pfam:Pkinase	207	311	1e-9	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.1%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,082,085	N299S	probably damaging	Het
Abi3	A	G	11: 95,832,715	*368R	probably null	Het
Agbl1	T	C	7: 76,698,840		probably null	Het
Ap3b2	T	C	7: 81,466,193	D650G	possibly damaging	Het
Arhgap30	A	G	1: 171,408,430	S791G	probably benign	Het
Arvcf	T	A	16: 18,403,458	L722Q	probably benign	Het
Ascc3	C	T	10: 50,718,402	R1198*	probably null	Het
Atf2	G	T	2: 73,829,856	T189N	probably benign	Het
Atf7ip	A	G	6: 136,559,816	K16E	probably damaging	Het
Atg9b	G	T	5: 24,387,398	Q621K	probably damaging	Het
Atp12a	G	A	14: 56,372,873	E234K	probably damaging	Het
C8a	T	C	4: 104,826,815	K368E	probably benign	Het
Cdh23	T	C	10: 60,530,978	Y241C	probably damaging	Het
Cdon	G	A	9: 35,486,807	S940N	probably benign	Het
Cds2	G	T	2: 132,305,155	G402V	possibly damaging	Het
Cog6	T	C	3: 52,992,750		probably null	Het
Commd10	T	C	18: 46,967,836	S114P	possibly damaging	Het
Dram2	T	C	3: 106,570,817	V155A	possibly damaging	Het
Egr2	T	A	10: 67,540,480	V252E	probably benign	Het
Exoc3l	C	T	8: 105,293,685	V203M	probably damaging	Het
Fsip1	C	A	2: 118,248,292		probably null	Het
Gm10840	C	A	11: 106,161,100		probably benign	Het
Gm8251	T	C	1: 44,057,205	K1578E	probably benign	Het
Gpr37l1	A	G	1: 135,161,145	L394P	probably damaging	Het
Gsap	T	C	5: 21,226,832	M243T	possibly damaging	Het
Hsd3b5	T	A	3: 98,619,144	I329F	probably benign	Het
Htra1	T	A	7: 130,961,532	S164R	probably damaging	Het
Il17b	G	A	18: 61,690,244	V50M	probably damaging	Het
Itga4	A	T	2: 79,301,031	Y581F	probably damaging	Het
Jmjd8	A	G	17: 25,829,281	E92G	probably damaging	Het
Kcnq4	T	A	4: 120,697,955	D677V	probably damaging	Het
Klhl42	A	G	6: 147,092,168	T213A	probably benign	Het
Lcn5	T	C	2: 25,660,698	S133P	probably damaging	Het
Liph	T	C	16: 21,968,053	Y271C	probably damaging	Het
Lpcat3	T	C	6: 124,701,474	I228T	probably benign	Het
Lrrd1	A	G	5: 3,866,418	K812E	possibly damaging	Het
Ltbp2	G	A	12: 84,809,587	T701I	probably damaging	Het
Ltbp2	T	C	12: 84,813,288	T631A	probably damaging	Het
Mavs	G	A	2: 131,238,831	R13Q	probably damaging	Het
Mtor	C	G	4: 148,464,949	H597D	probably benign	Het
Muc5b	T	A	7: 141,856,818	H1309Q	unknown	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Nnat	A	T	2: 157,560,488		probably benign	Het
Olfr183	G	A	16: 59,000,491	D269N	probably benign	Het
Olfr293	T	C	7: 86,664,340	L226S	possibly damaging	Het
Olfr703	T	A	7: 106,845,389	Y259*	probably null	Het
Olfr869	A	T	9: 20,137,191	Q25L	probably benign	Het
Pclo	C	T	5: 14,539,471	A595V	unknown	Het
Pcsk6	T	A	7: 65,962,928	C315S	probably damaging	Het
Pkd2	T	A	5: 104,455,805		probably benign	Het
Ppp2r3c	T	A	12: 55,293,821	I155F	probably damaging	Het
Rapgef4	A	G	2: 72,198,778	H398R	possibly damaging	Het
Ripor2	A	G	13: 24,694,226	D328G	probably damaging	Het
Rpgrip1	A	T	14: 52,141,144	T509S	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,267,183	I1032T	probably damaging	Het
Slc25a13	A	T	6: 6,109,277	S362T	probably benign	Het
Tal1	A	G	4: 115,068,565	D277G	probably damaging	Het
Tecta	G	A	9: 42,375,191	T723I	probably damaging	Het
Trp53bp1	A	C	2: 121,204,497	V103G	probably benign	Het
Trpv4	A	G	5: 114,636,457	S189P	probably benign	Het
Ttll5	T	G	12: 85,879,359		probably benign	Het
Usp8	A	G	2: 126,742,223	T451A	probably benign	Het
Vac14	G	A	8: 110,636,952	D340N	probably benign	Het
Vars	C	A	17: 34,998,066	A471S	probably benign	Het
Vars	A	T	17: 35,010,619	H404L	probably damaging	Het
Vmn2r70	T	C	7: 85,566,044	N94S	probably damaging	Het
Vpreb2	T	C	16: 17,980,767	L39P	probably damaging	Het
Vps13a	A	T	19: 16,640,810	L693*	probably null	Het
Wapl	A	G	14: 34,733,794	I176V	probably benign	Het
Wdr31	G	T	4: 62,464,033	L4I	possibly damaging	Het

Other mutations in Stk35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Stk35	APN	2	129801992	missense	probably damaging	1.00
IGL02609:Stk35	APN	2	129801801	missense	probably damaging	1.00
fingernails	UTSW	2	129810935	missense	probably damaging	1.00
R2256_Stk35_331	UTSW	2	129810507	nonsense	probably null
skinned	UTSW	2	129811235	intron	probably benign
R0306:Stk35	UTSW	2	129801763	nonsense	probably null
R0784:Stk35	UTSW	2	129810802	nonsense	probably null
R1536:Stk35	UTSW	2	129811235	intron	probably benign
R2256:Stk35	UTSW	2	129810507	nonsense	probably null
R2507:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R2508:Stk35	UTSW	2	129801515	missense	probably damaging	0.97
R3848:Stk35	UTSW	2	129800736	missense	probably benign	0.13
R3872:Stk35	UTSW	2	129810575	missense	possibly damaging	0.82
R4466:Stk35	UTSW	2	129801516	missense	probably damaging	0.99
R5144:Stk35	UTSW	2	129810935	missense	probably damaging	1.00
R6267:Stk35	UTSW	2	129810888	nonsense	probably null
R6296:Stk35	UTSW	2	129810888	nonsense	probably null
R6480:Stk35	UTSW	2	129810687	missense	possibly damaging	0.95
R6807:Stk35	UTSW	2	129801653	missense	probably damaging	0.97
R7203:Stk35	UTSW	2	129801593	missense	probably benign
R7476:Stk35	UTSW	2	129810725	missense	probably damaging	1.00
R8505:Stk35	UTSW	2	129801729	missense	probably damaging	0.99
R8998:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R8999:Stk35	UTSW	2	129810589	missense	probably damaging	1.00
R9224:Stk35	UTSW	2	129810571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAATCAGCATCAAGTGCCGAGTG -3'
(R):5'- AAAAGATCGGCTTCCGAGGACGAC -3'

Sequencing Primer
(F):5'- TACGATGCAGGTCAAGTCC -3'
(R):5'- AGGATGGTCCGTTCCGAG -3'

Posted On

2014-08-06