Incidental Mutation 'R0053:Alpi'
ID218404
Institutional Source Beutler Lab
Gene Symbol Alpi
Ensembl Gene ENSMUSG00000079440
Gene Namealkaline phosphatase, intestinal
Synonyms2010001C14Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0053 (G1)
Quality Score60
Status Validated
Chromosome1
Chromosomal Location87098002-87101606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87098790 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 493 (D493G)
Ref Sequence ENSEMBL: ENSMUSP00000108895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113270]
Predicted Effect probably benign
Transcript: ENSMUST00000113270
AA Change: D493G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108895
Gene: ENSMUSG00000079440
AA Change: D493G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
alkPPc 54 489 7.97e-247 SMART
low complexity region 509 532 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186823
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alkaline phosphatase, a metalloenzyme that catalyzes the hydrolysis of phosphoric acid monoesters. It belongs to a multigene family composed of four alkaline phosphatase isoenzymes. The enzyme functions as a homodimer and has a catalytic site containing one magnesium and two zinc ions, which are required for its enzymatic function. The protein is primarily expressed in placental and endometrial tissue; however, strong ectopic expression has been detected in ovarian adenocarcinoma, serous cystadenocarcinoma, and other ovarian cancer cells. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Alpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Alpi APN 1 87099720 missense probably damaging 1.00
IGL01972:Alpi APN 1 87099709 missense probably damaging 1.00
IGL02672:Alpi APN 1 87101272 missense probably damaging 1.00
IGL03089:Alpi APN 1 87100108 missense probably benign 0.05
IGL03099:Alpi APN 1 87098631 missense unknown
IGL03154:Alpi APN 1 87100088 missense probably damaging 1.00
IGL03372:Alpi APN 1 87100628 splice site probably benign
K7371:Alpi UTSW 1 87099171 splice site probably benign
R0054:Alpi UTSW 1 87099765 missense possibly damaging 0.61
R0070:Alpi UTSW 1 87101159 splice site probably benign
R1586:Alpi UTSW 1 87100201 missense probably damaging 1.00
R1835:Alpi UTSW 1 87099414 missense possibly damaging 0.88
R2372:Alpi UTSW 1 87100594 missense probably damaging 1.00
R4546:Alpi UTSW 1 87099117 missense probably damaging 1.00
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4968:Alpi UTSW 1 87101525 missense probably benign 0.05
R5427:Alpi UTSW 1 87101354 missense probably benign 0.04
R6245:Alpi UTSW 1 87100834 missense probably damaging 1.00
R6394:Alpi UTSW 1 87100706 missense possibly damaging 0.71
R6398:Alpi UTSW 1 87099462 missense probably damaging 0.98
R6616:Alpi UTSW 1 87101114 missense possibly damaging 0.81
R7168:Alpi UTSW 1 87099433 missense possibly damaging 0.94
R7448:Alpi UTSW 1 87101535 start codon destroyed possibly damaging 0.79
R7473:Alpi UTSW 1 87099647 critical splice donor site probably null
R7527:Alpi UTSW 1 87098955 missense probably benign 0.01
R7552:Alpi UTSW 1 87099073 missense probably benign 0.00
X0052:Alpi UTSW 1 87100201 missense probably damaging 1.00
X0057:Alpi UTSW 1 87101078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGTGTAGAAAACGGTGAACCC -3'
(R):5'- CAGATGGACGCTGCTCTCCTAAAC -3'

Sequencing Primer
(F):5'- AACCCGGAACTGATTGGGC -3'
(R):5'- TCCCTAGTTGATCCCAACTACAAG -3'
Posted On2014-08-06