Incidental Mutation 'R0053:Olfr1406'
ID218406
Institutional Source Beutler Lab
Gene Symbol Olfr1406
Ensembl Gene ENSMUSG00000058981
Gene Nameolfactory receptor 1406
SynonymsMOR267-5, GA_x6K02T2R7CC-664297-665229
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0053 (G1)
Quality Score61
Status Validated
Chromosome1
Chromosomal Location173181853-173190640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173184278 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000151023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072395] [ENSMUST00000201132] [ENSMUST00000215878]
Predicted Effect probably benign
Transcript: ENSMUST00000072395
AA Change: D52G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072231
Gene: ENSMUSG00000058981
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.9e-55 PFAM
Pfam:7tm_1 41 289 2.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201132
AA Change: D52G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144530
Gene: ENSMUSG00000058981
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 31 88 5.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215878
AA Change: D52G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Olfr1406
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr1406 APN 1 173183623 missense probably benign 0.45
IGL01609:Olfr1406 APN 1 173184276 missense probably benign 0.00
IGL01996:Olfr1406 APN 1 173183727 missense probably benign 0.00
F5770:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
PIT4378001:Olfr1406 UTSW 1 173183814 missense probably benign 0.00
R0800:Olfr1406 UTSW 1 173184060 missense probably damaging 1.00
R1793:Olfr1406 UTSW 1 173184409 missense probably benign
R2230:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R2232:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R5395:Olfr1406 UTSW 1 173183680 nonsense probably null
R5455:Olfr1406 UTSW 1 173184251 missense probably damaging 1.00
R5457:Olfr1406 UTSW 1 173183613 missense probably damaging 1.00
R5558:Olfr1406 UTSW 1 173184018 missense probably benign 0.01
R5760:Olfr1406 UTSW 1 173183751 missense probably benign 0.05
R6285:Olfr1406 UTSW 1 173183910 missense probably damaging 1.00
R7159:Olfr1406 UTSW 1 173184323 missense possibly damaging 0.95
R7676:Olfr1406 UTSW 1 173183553 nonsense probably null
V7580:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7581:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7582:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCTCCCACTGAAGATGCCAGAATG -3'
(R):5'- GAGCTGAGTCTCTGCTGTACTCAAAG -3'

Sequencing Primer
(F):5'- GACAGTTGGTGATTGCAAATCC -3'
(R):5'- GGTCAGTGTCACTTCTTTACTAAGAC -3'
Posted On2014-08-06