Mutagenetix > Incidental Mutations

Incidental Mutation 'R0134:Prickle1'

21841

Institutional Source

Beutler Lab

Gene Symbol

Prickle1

Ensembl Gene

ENSMUSG00000036158

Gene Name

prickle planar cell polarity protein 1

Synonyms

1110058P22Rik, b2b019Clo, mpk1

MMRRC Submission

038419-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0134 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

93499114-93595891 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93510777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 47 (L47P)

Ref Sequence

ENSEMBL: ENSMUSP00000104878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048982] [ENSMUST00000109255]

AlphaFold

Q3U5C7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048982
AA Change: L47P

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000049204
Gene: ENSMUSG00000036158
AA Change: L47P

Domain	Start	End	E-Value	Type
Pfam:PET	16	116	2.2e-46	PFAM
LIM	125	182	1.73e-9	SMART
LIM	190	242	1.13e-13	SMART
LIM	250	305	2.37e-7	SMART
low complexity region	314	343	N/A	INTRINSIC
low complexity region	667	684	N/A	INTRINSIC
low complexity region	758	776	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109255
AA Change: L47P

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000104878
Gene: ENSMUSG00000036158
AA Change: L47P

Domain	Start	End	E-Value	Type
Pfam:PET	13	118	3.7e-46	PFAM
LIM	125	182	1.73e-9	SMART
LIM	190	242	1.13e-13	SMART
LIM	250	305	2.37e-7	SMART
low complexity region	314	343	N/A	INTRINSIC
low complexity region	667	684	N/A	INTRINSIC
low complexity region	758	776	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC

Meta Mutation Damage Score

0.1515

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.4%
20x: 93.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor that may be a negative regulator of the Wnt/beta-catenin signaling pathway. The encoded protein localizes to the nuclear membrane and has been implicated in the nuclear trafficking of the transcription repressors REST/NRSF and REST4. Mutations in this gene have been linked to progressive myoclonus epilepsy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous null or point mutations result in decreased seizure threshold. Homozygous null mice display early embryonic lethality associated with altered epiblast apical-basal polarity, failed anterior migration of the distal visceral endoderm, and lackof mesoderm and primitive streak formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	G	A	18: 38,261,264	V505I	probably benign	Het
1110059E24Rik	T	C	19: 21,598,201		probably benign	Het
Abca16	T	A	7: 120,540,155	L1470Q	probably damaging	Het
Arhgap23	G	T	11: 97,444,328	V70L	probably benign	Het
AW549877	T	C	15: 3,986,294	K263E	probably damaging	Het
Bicd1	T	C	6: 149,512,950	I387T	probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cd59b	G	A	2: 104,078,941		probably null	Het
Ddx50	A	T	10: 62,621,377		probably benign	Het
Dnlz	T	C	2: 26,351,368	N116S	probably damaging	Het
Efcab14	T	C	4: 115,740,531	F108L	probably damaging	Het
Esyt2	A	G	12: 116,367,710	N736S	probably damaging	Het
Exoc4	A	G	6: 33,971,946	D908G	possibly damaging	Het
Garnl3	T	C	2: 33,006,804	T608A	possibly damaging	Het
Hdac2	T	A	10: 36,989,184	D131E	probably benign	Het
Hes1	T	C	16: 30,067,250	V224A	probably damaging	Het
Hps1	G	T	19: 42,766,180	Q277K	probably damaging	Het
Ighv15-2	T	G	12: 114,565,037		probably benign	Het
Il3	A	G	11: 54,265,680		probably null	Het
Itgae	A	C	11: 73,111,342	M91L	probably benign	Het
Kctd21	T	A	7: 97,348,091	I257N	probably benign	Het
Kif16b	A	T	2: 142,672,375	S1215T	probably benign	Het
Lhx9	A	T	1: 138,838,679	C124S	probably damaging	Het
Lipo4	A	G	19: 33,501,606	V278A	probably benign	Het
Lrp1b	T	C	2: 40,596,983	E142G	probably damaging	Het
Macf1	T	C	4: 123,432,843	M2835V	possibly damaging	Het
Map9	G	A	3: 82,359,983		probably benign	Het
Miox	C	T	15: 89,334,454		probably benign	Het
Mndal	A	T	1: 173,857,513		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Nepn	A	T	10: 52,400,437	T29S	probably damaging	Het
Nlgn1	C	T	3: 25,435,925	C546Y	probably damaging	Het
Olfr1055	T	C	2: 86,347,728	I13V	possibly damaging	Het
Olfr307	A	G	7: 86,335,595	I267T	probably benign	Het
Pdgfra	A	G	5: 75,166,511	D123G	probably damaging	Het
Plekhn1	T	C	4: 156,228,243	R53G	probably benign	Het
Pnp2	T	C	14: 50,963,177	F100S	probably damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rxfp1	A	G	3: 79,657,476	S327P	probably damaging	Het
Siah2	A	G	3: 58,676,115	V250A	probably damaging	Het
Siglecg	G	A	7: 43,411,171	G325D	probably damaging	Het
Slc10a7	T	A	8: 78,697,158		probably null	Het
Slc9a1	A	G	4: 133,420,605	K645E	probably benign	Het
Smarca4	T	C	9: 21,637,324	L302P	probably damaging	Het
Smyd1	G	T	6: 71,216,765	T392N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tenm3	A	T	8: 48,674,472	L57Q	probably damaging	Het
Tep1	C	T	14: 50,829,693	V2269I	possibly damaging	Het
Tpd52l1	A	G	10: 31,379,256	S32P	probably damaging	Het
Tsfm	A	G	10: 127,022,929		probably benign	Het
Ttn	T	A	2: 76,710,124	R34173W	probably damaging	Het
Ttn	C	A	2: 76,793,130	V15368L	possibly damaging	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vps13b	T	C	15: 35,887,261	I3272T	probably benign	Het
Zfp108	A	G	7: 24,260,467	H161R	probably benign	Het
Zfp518b	A	G	5: 38,674,659	M1T	probably null	Het

Other mutations in Prickle1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00578:Prickle1	APN	15	93500781	missense	probably benign	0.29
IGL01641:Prickle1	APN	15	93500572	missense	probably benign	0.05
IGL01917:Prickle1	APN	15	93503527	missense	probably damaging	0.99
IGL02124:Prickle1	APN	15	93503146	missense	probably damaging	1.00
IGL02754:Prickle1	APN	15	93501153	missense	possibly damaging	0.94
P0028:Prickle1	UTSW	15	93500902	missense	probably damaging	1.00
R0189:Prickle1	UTSW	15	93503019	nonsense	probably null
R0225:Prickle1	UTSW	15	93510777	missense	possibly damaging	0.63
R0556:Prickle1	UTSW	15	93500781	missense	probably benign	0.29
R1144:Prickle1	UTSW	15	93512461	missense	probably damaging	0.99
R1440:Prickle1	UTSW	15	93505074	missense	possibly damaging	0.85
R1458:Prickle1	UTSW	15	93500638	missense	probably damaging	1.00
R2420:Prickle1	UTSW	15	93503637	missense	probably damaging	1.00
R2656:Prickle1	UTSW	15	93503370	missense	probably benign	0.32
R2864:Prickle1	UTSW	15	93509278	missense	probably damaging	0.99
R4301:Prickle1	UTSW	15	93508636	missense	possibly damaging	0.82
R4912:Prickle1	UTSW	15	93500548	missense	probably benign	0.00
R5085:Prickle1	UTSW	15	93500902	missense	probably damaging	1.00
R5773:Prickle1	UTSW	15	93508597	missense	probably damaging	1.00
R5836:Prickle1	UTSW	15	93503017	nonsense	probably null
R5902:Prickle1	UTSW	15	93510672	missense	probably null	0.82
R7022:Prickle1	UTSW	15	93500871	missense	possibly damaging	0.82
R7474:Prickle1	UTSW	15	93508671	missense	possibly damaging	0.88
R7851:Prickle1	UTSW	15	93500559	missense	possibly damaging	0.49
R9300:Prickle1	UTSW	15	93500868	missense	possibly damaging	0.89
R9405:Prickle1	UTSW	15	93502980	nonsense	probably null
X0066:Prickle1	UTSW	15	93503194	missense	probably benign	0.00
X0067:Prickle1	UTSW	15	93508681	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- GGTGCATTTTAAGAGAGGCCGAGC -3'
(R):5'- GGTCACTTACAGAAGTCACCCAGC -3'

Sequencing Primer
(F):5'- agctgggacttcagaaagac -3'
(R):5'- GCATTCCTGAGGAGCAATTTAGC -3'

Posted On

2013-04-12