Mutagenetix > Incidental Mutation

Incidental Mutation 'R0053:Snd1'

218411

Institutional Source

Beutler Lab

Gene Symbol

Snd1

Ensembl Gene

ENSMUSG00000001424

Gene Name

staphylococcal nuclease and tudor domain containing 1

Synonyms

p100 co-activator, Tudor-SN

MMRRC Submission

038347-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R0053 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

28475139-28935162 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 28745335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]

AlphaFold

Q78PY7

Predicted Effect

probably benign
Transcript: ENSMUST00000001460

SMART Domains

Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SNc	525	660	3.82e-45	SMART
TUDOR	728	785	4.8e-19	SMART
Pfam:SNase	835	895	1.3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164915

SMART Domains

Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	142	1.56e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167201

SMART Domains

Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SCOP:d1sty__	526	592	1e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171353

SMART Domains

Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

Domain	Start	End	E-Value	Type
low complexity region	29	39	N/A	INTRINSIC
transmembrane domain	104	126	N/A	INTRINSIC
low complexity region	152	163	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.5%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,327,590	D711E	probably benign	Het
5730559C18Rik	C	T	1: 136,227,550	V106I	probably benign	Het
Ada	A	T	2: 163,732,292	V148D	probably damaging	Het
Alpi	T	C	1: 87,098,790	D493G	probably benign	Het
Atp10b	A	G	11: 43,216,564		probably benign	Het
AY761185	A	T	8: 20,944,530		probably benign	Het
BC067074	T	C	13: 113,368,489	W2051R	probably benign	Het
Cadm1	C	T	9: 47,799,414	T205I	probably damaging	Het
Capn3	A	G	2: 120,491,837	I413V	possibly damaging	Het
Cblb	C	T	16: 52,142,801	T369I	probably damaging	Het
Ccdc54	T	A	16: 50,590,234	N223I	probably benign	Het
Cdc25c	A	G	18: 34,735,435	V294A	probably benign	Het
Cep170	A	T	1: 176,782,380	S122T	possibly damaging	Het
Chd1	A	G	17: 15,747,189	N849D	probably damaging	Het
Dpp3	A	G	19: 4,923,126	C147R	probably damaging	Het
Dst	A	G	1: 34,294,550		probably null	Het
Fbxw9	T	A	8: 85,064,454	L250Q	probably damaging	Het
Gpr75	A	T	11: 30,892,571	Q492L	possibly damaging	Het
Gramd4	T	A	15: 86,130,138		probably benign	Het
Hivep2	T	C	10: 14,132,121	C1488R	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Insr	A	G	8: 3,155,683	S1369P	probably damaging	Het
Insrr	A	C	3: 87,800,452	D67A	probably damaging	Het
Irf2	T	A	8: 46,818,851	Y158N	probably benign	Het
Katnbl1	A	G	2: 112,404,241	R23G	probably benign	Het
Lamb2	T	A	9: 108,486,737	C987*	probably null	Het
Lzts2	T	C	19: 45,026,307		probably benign	Het
Mmp14	T	A	14: 54,438,652		probably benign	Het
Mycbpap	A	G	11: 94,511,736	Y258H	probably damaging	Het
Nav3	A	G	10: 109,766,917		probably benign	Het
Olfr1186	T	A	2: 88,526,163	N193K	probably damaging	Het
Olfr1406	T	C	1: 173,184,278	D52G	probably benign	Het
Parp10	T	A	15: 76,242,246	L247F	probably damaging	Het
Pcsk6	C	T	7: 65,983,703		probably benign	Het
Pgap3	A	T	11: 98,391,098	V129D	probably benign	Het
Pibf1	A	G	14: 99,140,557	Y373C	probably damaging	Het
Plcb1	A	G	2: 135,294,915	E310G	probably benign	Het
Plin3	T	C	17: 56,279,892	D385G	probably damaging	Het
Pole	A	T	5: 110,293,340	D220V	probably damaging	Het
Ptprk	T	A	10: 28,475,109	F533I	probably damaging	Het
Rufy1	A	T	11: 50,401,465	M499K	probably benign	Het
Scn1a	T	G	2: 66,299,775	D1232A	probably benign	Het
Sec23ip	T	C	7: 128,745,167	L49P	probably damaging	Het
Sf3b1	G	A	1: 55,000,373	Q698*	probably null	Het
Shprh	A	T	10: 11,194,372		probably null	Het
Stab1	C	T	14: 31,140,687	A2260T	possibly damaging	Het
Stpg2	A	G	3: 139,212,321	Q60R	probably benign	Het
Strn	T	C	17: 78,656,934	H687R	possibly damaging	Het
Tgfb3	A	T	12: 86,077,829	I35N	probably damaging	Het
Tnks2	T	C	19: 36,875,365	S166P	probably damaging	Het
Tyw5	G	A	1: 57,401,438	T55M	probably damaging	Het
Usp19	A	G	9: 108,497,170		probably null	Het
Zfp13	A	T	17: 23,576,148	I483N	probably damaging	Het

Other mutations in Snd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Snd1	APN	6	28512986	critical splice donor site	probably null
IGL00940:Snd1	APN	6	28745175	intron	probably benign
IGL01340:Snd1	APN	6	28883369	missense	probably benign
IGL01892:Snd1	APN	6	28888124	critical splice donor site	probably null
IGL02063:Snd1	APN	6	28526221	unclassified	probably benign
IGL02134:Snd1	APN	6	28880279	missense	possibly damaging	0.81
IGL02366:Snd1	APN	6	28707150	intron	probably benign
PIT4677001:Snd1	UTSW	6	28880296	missense	probably benign	0.01
R0039:Snd1	UTSW	6	28745210	missense	probably damaging	1.00
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0463:Snd1	UTSW	6	28724956	missense	probably benign	0.00
R0576:Snd1	UTSW	6	28886577	missense	probably benign	0.31
R0709:Snd1	UTSW	6	28545470	splice site	probably benign
R0959:Snd1	UTSW	6	28884971	missense	probably benign	0.01
R1698:Snd1	UTSW	6	28888253	nonsense	probably null
R1853:Snd1	UTSW	6	28545564	missense	probably damaging	1.00
R2059:Snd1	UTSW	6	28745207	missense	probably damaging	1.00
R2497:Snd1	UTSW	6	28888079	missense	probably benign
R3832:Snd1	UTSW	6	28531404	splice site	probably benign
R3833:Snd1	UTSW	6	28531404	splice site	probably benign
R4643:Snd1	UTSW	6	28880249	missense	probably benign	0.00
R4665:Snd1	UTSW	6	28707054	missense	probably damaging	1.00
R4843:Snd1	UTSW	6	28668643	missense	probably damaging	1.00
R4884:Snd1	UTSW	6	28526912	missense	possibly damaging	0.94
R4959:Snd1	UTSW	6	28884251	nonsense	probably null
R4973:Snd1	UTSW	6	28884251	nonsense	probably null
R5065:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5066:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5067:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5131:Snd1	UTSW	6	28885050	missense	probably damaging	0.99
R5172:Snd1	UTSW	6	28886616	missense	possibly damaging	0.91
R5239:Snd1	UTSW	6	28545525	missense	probably damaging	1.00
R5313:Snd1	UTSW	6	28668601	missense	probably benign	0.15
R5395:Snd1	UTSW	6	28526184	missense	probably damaging	0.99
R5938:Snd1	UTSW	6	28874859	critical splice acceptor site	probably null
R6019:Snd1	UTSW	6	28880234	missense	probably benign	0.00
R6248:Snd1	UTSW	6	28520235	nonsense	probably null
R6337:Snd1	UTSW	6	28888289	missense	probably damaging	1.00
R6810:Snd1	UTSW	6	28668610	missense	probably benign	0.23
R6932:Snd1	UTSW	6	28626101	missense	probably benign	0.42
R7469:Snd1	UTSW	6	28626127	missense	probably damaging	1.00
R7485:Snd1	UTSW	6	28531450	missense	probably benign	0.14
R7571:Snd1	UTSW	6	28526203	missense	possibly damaging	0.81
R7866:Snd1	UTSW	6	28527725	missense	probably damaging	1.00
R8178:Snd1	UTSW	6	28874976	missense	possibly damaging	0.85
R8208:Snd1	UTSW	6	28526055	missense	possibly damaging	0.86
R8526:Snd1	UTSW	6	28745254	missense	probably benign	0.00
R8848:Snd1	UTSW	6	28874963	missense	possibly damaging	0.72
R8854:Snd1	UTSW	6	28526969	missense	probably benign	0.02
R9310:Snd1	UTSW	6	28795937	missense	probably null	1.00
R9326:Snd1	UTSW	6	28795843	nonsense	probably null
R9348:Snd1	UTSW	6	28745207	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAATGAGCACCTATCTGTGCCC -3'
(R):5'- TCCTGAGGCTGCTTACTACTGACAC -3'

Sequencing Primer
(F):5'- CAAAGGAGCGTGTGTCCTG -3'
(R):5'- TGCTTACTACTGACACGGCAG -3'

Posted On

2014-08-06