Incidental Mutation 'R0053:Snd1'
ID218411
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Namestaphylococcal nuclease and tudor domain containing 1
Synonymsp100 co-activator, Tudor-SN
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R0053 (G1)
Quality Score69
Status Validated
Chromosome6
Chromosomal Location28475139-28935162 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 28745335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]
Predicted Effect probably benign
Transcript: ENSMUST00000001460
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171353
SMART Domains Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

DomainStartEndE-ValueType
low complexity region 29 39 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28512986 critical splice donor site probably null
IGL00940:Snd1 APN 6 28745175 intron probably benign
IGL01340:Snd1 APN 6 28883369 missense probably benign
IGL01892:Snd1 APN 6 28888124 critical splice donor site probably null
IGL02063:Snd1 APN 6 28526221 unclassified probably benign
IGL02134:Snd1 APN 6 28880279 missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28707150 intron probably benign
PIT4677001:Snd1 UTSW 6 28880296 missense probably benign 0.01
R0039:Snd1 UTSW 6 28745210 missense probably damaging 1.00
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0463:Snd1 UTSW 6 28724956 missense probably benign 0.00
R0576:Snd1 UTSW 6 28886577 missense probably benign 0.31
R0709:Snd1 UTSW 6 28545470 splice site probably benign
R0959:Snd1 UTSW 6 28884971 missense probably benign 0.01
R1698:Snd1 UTSW 6 28888253 nonsense probably null
R1853:Snd1 UTSW 6 28545564 missense probably damaging 1.00
R2059:Snd1 UTSW 6 28745207 missense probably damaging 1.00
R2497:Snd1 UTSW 6 28888079 missense probably benign
R3832:Snd1 UTSW 6 28531404 splice site probably benign
R3833:Snd1 UTSW 6 28531404 splice site probably benign
R4643:Snd1 UTSW 6 28880249 missense probably benign 0.00
R4665:Snd1 UTSW 6 28707054 missense probably damaging 1.00
R4843:Snd1 UTSW 6 28668643 missense probably damaging 1.00
R4884:Snd1 UTSW 6 28526912 missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28884251 nonsense probably null
R4973:Snd1 UTSW 6 28884251 nonsense probably null
R5065:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5066:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5067:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5131:Snd1 UTSW 6 28885050 missense probably damaging 0.99
R5172:Snd1 UTSW 6 28886616 missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28545525 missense probably damaging 1.00
R5313:Snd1 UTSW 6 28668601 missense probably benign 0.15
R5395:Snd1 UTSW 6 28526184 missense probably damaging 0.99
R5938:Snd1 UTSW 6 28874859 critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28880234 missense probably benign 0.00
R6248:Snd1 UTSW 6 28520235 nonsense probably null
R6337:Snd1 UTSW 6 28888289 missense probably damaging 1.00
R6810:Snd1 UTSW 6 28668610 missense probably benign 0.23
R6932:Snd1 UTSW 6 28626101 missense probably benign 0.42
R7469:Snd1 UTSW 6 28626127 missense probably damaging 1.00
R7485:Snd1 UTSW 6 28531450 missense probably benign 0.14
R7571:Snd1 UTSW 6 28526203 missense possibly damaging 0.81
R7866:Snd1 UTSW 6 28527725 missense probably damaging 1.00
R7949:Snd1 UTSW 6 28527725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAATGAGCACCTATCTGTGCCC -3'
(R):5'- TCCTGAGGCTGCTTACTACTGACAC -3'

Sequencing Primer
(F):5'- CAAAGGAGCGTGTGTCCTG -3'
(R):5'- TGCTTACTACTGACACGGCAG -3'
Posted On2014-08-06