Incidental Mutation 'R0053:Pcsk6'
Institutional Source Beutler Lab
Gene Symbol Pcsk6
Ensembl Gene ENSMUSG00000030513
Gene Nameproprotein convertase subtilisin/kexin type 6
SynonymsPACE4, SPC4
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R0053 (G1)
Quality Score58
Status Validated
Chromosomal Location65861734-66050386 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 65983703 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176209]
Predicted Effect probably benign
Transcript: ENSMUST00000055576
SMART Domains Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513

signal peptide 1 54 N/A INTRINSIC
Pfam:S8_pro-domain 65 141 3.1e-29 PFAM
Pfam:Peptidase_S8 186 469 5.2e-49 PFAM
Pfam:P_proprotein 529 619 9.7e-37 PFAM
FU 682 729 5.87e-11 SMART
EGF_like 688 737 5.03e1 SMART
FU 733 780 4.35e-14 SMART
EGF_like 738 771 3.57e1 SMART
FU 784 828 2.08e-11 SMART
EGF 789 819 2.48e1 SMART
FU 832 877 9.4e-10 SMART
EGF_like 837 868 6.28e1 SMART
FU 885 933 8.58e-4 SMART
EGF 890 920 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098391
SMART Domains Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513

signal peptide 1 54 N/A INTRINSIC
PDB:1KN6|A 62 129 2e-6 PDB
low complexity region 131 144 N/A INTRINSIC
Pfam:Peptidase_S8 190 478 1.1e-58 PFAM
Pfam:P_proprotein 529 619 4.5e-37 PFAM
FU 669 716 3.87e-11 SMART
EGF_like 675 724 5.03e1 SMART
FU 720 767 4.35e-14 SMART
EGF_like 725 758 3.57e1 SMART
FU 771 815 2.08e-11 SMART
EGF 776 806 2.48e1 SMART
FU 819 864 9.4e-10 SMART
EGF_like 824 855 6.28e1 SMART
FU 872 920 8.58e-4 SMART
EGF 877 907 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176209
SMART Domains Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513

low complexity region 44 57 N/A INTRINSIC
Pfam:Peptidase_S8 103 372 6.5e-50 PFAM
Pfam:P_proprotein 368 458 6.2e-37 PFAM
FU 521 568 5.87e-11 SMART
EGF_like 527 576 5.03e1 SMART
FU 572 619 4.35e-14 SMART
EGF_like 577 610 3.57e1 SMART
FU 623 667 2.08e-11 SMART
EGF 628 658 2.48e1 SMART
FU 671 716 9.4e-10 SMART
EGF_like 676 707 6.28e1 SMART
FU 724 772 8.58e-4 SMART
EGF 729 759 1.69e1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pgap3 A T 11: 98,391,098 V129D probably benign Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Pcsk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pcsk6 APN 7 65927820 missense probably damaging 1.00
IGL01609:Pcsk6 APN 7 66035273 splice site probably null
IGL01986:Pcsk6 APN 7 65927877 missense probably damaging 1.00
IGL02592:Pcsk6 APN 7 65969028 missense probably damaging 1.00
IGL02720:Pcsk6 APN 7 65980247 nonsense probably null
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0119:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0299:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0415:Pcsk6 UTSW 7 66033874 missense probably damaging 1.00
R0496:Pcsk6 UTSW 7 65927249 missense probably benign 0.00
R0518:Pcsk6 UTSW 7 65980167 missense possibly damaging 0.64
R0748:Pcsk6 UTSW 7 66038968 unclassified probably benign
R1456:Pcsk6 UTSW 7 66043535 missense possibly damaging 0.87
R1613:Pcsk6 UTSW 7 65910311 splice site probably benign
R1680:Pcsk6 UTSW 7 66035250 missense probably benign 0.14
R1682:Pcsk6 UTSW 7 65910228 missense probably damaging 1.00
R1987:Pcsk6 UTSW 7 65927287 missense possibly damaging 0.60
R4191:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4193:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4577:Pcsk6 UTSW 7 65959266 nonsense probably null
R4592:Pcsk6 UTSW 7 65931732 missense possibly damaging 0.54
R4687:Pcsk6 UTSW 7 65983753 missense probably damaging 1.00
R4697:Pcsk6 UTSW 7 65959241 missense probably damaging 1.00
R4778:Pcsk6 UTSW 7 65959145 missense probably damaging 1.00
R5065:Pcsk6 UTSW 7 65910299 missense possibly damaging 0.84
R5218:Pcsk6 UTSW 7 66025288 missense probably benign 0.01
R5356:Pcsk6 UTSW 7 65970592 missense probably damaging 1.00
R5427:Pcsk6 UTSW 7 66033899 missense probably benign 0.01
R5589:Pcsk6 UTSW 7 65929185 critical splice donor site probably null
R5637:Pcsk6 UTSW 7 65968997 missense probably damaging 1.00
R5888:Pcsk6 UTSW 7 66043624 missense probably null
R5958:Pcsk6 UTSW 7 66043611 missense probably damaging 1.00
R5997:Pcsk6 UTSW 7 65959293 missense probably damaging 1.00
R6191:Pcsk6 UTSW 7 65929127 missense probably benign 0.19
R6274:Pcsk6 UTSW 7 66033844 missense probably damaging 1.00
R6374:Pcsk6 UTSW 7 65980155 missense possibly damaging 0.80
R6393:Pcsk6 UTSW 7 65969014 missense probably damaging 1.00
R6730:Pcsk6 UTSW 7 65980248 missense probably damaging 1.00
R7205:Pcsk6 UTSW 7 66025408 critical splice donor site probably null
R7493:Pcsk6 UTSW 7 66043566 missense possibly damaging 0.53
R7570:Pcsk6 UTSW 7 66033898 missense probably benign 0.03
R7731:Pcsk6 UTSW 7 66033893 missense probably benign 0.00
R7779:Pcsk6 UTSW 7 66025404 missense probably benign 0.03
R8042:Pcsk6 UTSW 7 65927935 missense possibly damaging 0.87
R8734:Pcsk6 UTSW 7 65931733 missense probably benign 0.06
R8805:Pcsk6 UTSW 7 65929143 missense possibly damaging 0.67
R8987:Pcsk6 UTSW 7 65927227 nonsense probably null
Z1177:Pcsk6 UTSW 7 65959113 missense probably damaging 1.00
Z1177:Pcsk6 UTSW 7 66033811 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- caaggcagtcctatggctaag -3'
Posted On2014-08-06