Incidental Mutation 'R0053:Irf2'
ID218413
Institutional Source Beutler Lab
Gene Symbol Irf2
Ensembl Gene ENSMUSG00000031627
Gene Nameinterferon regulatory factor 2
SynonymsIrf-2, 9830146E22Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R0053 (G1)
Quality Score45
Status Validated
Chromosome8
Chromosomal Location46739732-46847458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46818851 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 158 (Y158N)
Ref Sequence ENSEMBL: ENSMUSP00000034041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034041] [ENSMUST00000207105] [ENSMUST00000210218] [ENSMUST00000210284]
PDB Structure
INTERFERON REGULATORY FACTOR-2 DNA BINDING DOMAIN, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
INTERFERON REGULATORY FACTOR-2 DNA BINDING DOMAIN, NMR, 20 STRUCTURES [SOLUTION NMR]
CRYSTAL STRUCTURE OF AN IRF-2/DNA COMPLEX. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034041
AA Change: Y158N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034041
Gene: ENSMUSG00000031627
AA Change: Y158N

DomainStartEndE-ValueType
IRF 1 114 4.09e-61 SMART
low complexity region 115 132 N/A INTRINSIC
Blast:IRF 247 301 3e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207105
AA Change: Y120N

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209820
Predicted Effect probably benign
Transcript: ENSMUST00000210218
Predicted Effect probably benign
Transcript: ENSMUST00000210284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210334
Meta Mutation Damage Score 0.4991 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF2 encodes interferon regulatory factor 2, a member of the interferon regulatory transcription factor (IRF) family. IRF2 competitively inhibits the IRF1-mediated transcriptional activation of interferons alpha and beta, and presumably other genes that employ IRF1 for transcription activation. However, IRF2 also functions as a transcriptional activator of histone H4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in B lymphopoiesis and hematopoiesis, often die prematurely, show increased mortality following lymphocytic choriomeningitis virus infection, and develop an inflammatory skin disease involving CD8+ Tcells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Irf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irf2 APN 8 46807225 missense probably damaging 1.00
IGL02251:Irf2 APN 8 46807753 critical splice donor site probably null
IGL02403:Irf2 APN 8 46846172 missense probably damaging 1.00
IGL03208:Irf2 APN 8 46807305 missense probably damaging 1.00
Gentle UTSW 8 46807281 missense probably damaging 1.00
softie UTSW 8 46807279 missense probably damaging 1.00
R0053:Irf2 UTSW 8 46818851 missense probably benign 0.44
R0411:Irf2 UTSW 8 46846061 missense probably benign
R1523:Irf2 UTSW 8 46837840 critical splice donor site probably null
R1888:Irf2 UTSW 8 46807353 nonsense probably null
R1888:Irf2 UTSW 8 46807353 nonsense probably null
R2059:Irf2 UTSW 8 46807345 missense probably damaging 1.00
R2076:Irf2 UTSW 8 46845927 missense probably damaging 0.97
R2259:Irf2 UTSW 8 46837833 missense probably benign 0.00
R4691:Irf2 UTSW 8 46846187 missense probably damaging 1.00
R5722:Irf2 UTSW 8 46818796 missense possibly damaging 0.95
R7163:Irf2 UTSW 8 46837677 missense possibly damaging 0.83
R7216:Irf2 UTSW 8 46793556 missense probably benign
R7337:Irf2 UTSW 8 46807281 missense probably damaging 1.00
R7792:Irf2 UTSW 8 46807279 missense probably damaging 1.00
X0053:Irf2 UTSW 8 46807267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGATGTGCTGAGAACATTTCC -3'
(R):5'- TTGGACACGTTCCAAGACCTCCTC -3'

Sequencing Primer
(F):5'- TGCATTTGGGACATGACACG -3'
(R):5'- AAGACCTCCTCTTACTGACTGTG -3'
Posted On2014-08-06