Incidental Mutation 'R0053:Mycbpap'
Institutional Source Beutler Lab
Gene Symbol Mycbpap
Ensembl Gene ENSMUSG00000039110
Gene NameMYCBP associated protein
SynonymsAMAP-1, 4932408B01Rik
MMRRC Submission 038347-MU
Accession Numbers

NCBI RefSeq: NM_170671.2; MGI: 2388726

Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R0053 (G1)
Quality Score78
Status Validated
Chromosomal Location94501347-94521742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94511736 bp
Amino Acid Change Tyrosine to Histidine at position 258 (Y258H)
Ref Sequence ENSEMBL: ENSMUSP00000091477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040692] [ENSMUST00000093945]
Predicted Effect probably benign
Transcript: ENSMUST00000040692
SMART Domains Protein: ENSMUSP00000047579
Gene: ENSMUSG00000039110

Pfam:MYCBPAP 6 85 2.3e-19 PFAM
low complexity region 330 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093945
AA Change: Y258H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091477
Gene: ENSMUSG00000039110
AA Change: Y258H

low complexity region 23 36 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:MYCBPAP 184 602 3.7e-144 PFAM
low complexity region 848 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151993
Meta Mutation Damage Score 0.2053 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Mycbpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Mycbpap APN 11 94509319 splice site probably null
IGL01372:Mycbpap APN 11 94506456 missense possibly damaging 0.56
IGL01627:Mycbpap APN 11 94514604 missense probably damaging 0.98
IGL01645:Mycbpap APN 11 94503467 splice site probably null
IGL01712:Mycbpap APN 11 94512655 missense possibly damaging 0.50
IGL02209:Mycbpap APN 11 94509882 splice site probably benign
IGL02377:Mycbpap APN 11 94503250 missense probably damaging 1.00
IGL03088:Mycbpap APN 11 94513943 critical splice acceptor site probably null
IGL03412:Mycbpap APN 11 94508101 splice site probably null
IGL03046:Mycbpap UTSW 11 94505717 missense possibly damaging 0.84
P0008:Mycbpap UTSW 11 94504067 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0437:Mycbpap UTSW 11 94513512 splice site probably benign
R0706:Mycbpap UTSW 11 94513786 nonsense probably null
R0791:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1496:Mycbpap UTSW 11 94505561 missense probably benign 0.11
R1522:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1698:Mycbpap UTSW 11 94508143 nonsense probably null
R1796:Mycbpap UTSW 11 94507551 missense probably damaging 1.00
R1906:Mycbpap UTSW 11 94505621 missense probably benign 0.24
R4115:Mycbpap UTSW 11 94512225 splice site probably null
R4930:Mycbpap UTSW 11 94503157 missense probably benign 0.20
R4965:Mycbpap UTSW 11 94504938 missense probably damaging 1.00
R5323:Mycbpap UTSW 11 94503504 missense probably benign 0.00
R5326:Mycbpap UTSW 11 94507746 splice site probably null
R5542:Mycbpap UTSW 11 94507746 splice site probably null
R5625:Mycbpap UTSW 11 94505693 missense probably damaging 0.99
R5841:Mycbpap UTSW 11 94505610 missense probably damaging 1.00
R5996:Mycbpap UTSW 11 94513594 missense probably benign
R6065:Mycbpap UTSW 11 94508187 splice site probably null
R6192:Mycbpap UTSW 11 94507731 missense probably damaging 1.00
R7027:Mycbpap UTSW 11 94514614 missense probably damaging 1.00
R7329:Mycbpap UTSW 11 94509247 missense probably damaging 1.00
R7513:Mycbpap UTSW 11 94503556 missense probably damaging 1.00
R8485:Mycbpap UTSW 11 94511708 missense probably damaging 0.96
R8485:Mycbpap UTSW 11 94514533 missense probably benign 0.01
Z1177:Mycbpap UTSW 11 94509854 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcatagaaacaccaccaaagaac -3'
Posted On2014-08-06