Incidental Mutation 'R0053:Mmp14'
ID218416
Institutional Source Beutler Lab
Gene Symbol Mmp14
Ensembl Gene ENSMUSG00000000957
Gene Namematrix metallopeptidase 14 (membrane-inserted)
Synonymssabe, Membrane type 1-MMP, MT1-MMP
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R0053 (G1)
Quality Score60
Status Validated
Chromosome14
Chromosomal Location54431612-54445364 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 54438652 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089688] [ENSMUST00000196155] [ENSMUST00000197874] [ENSMUST00000225641]
Predicted Effect probably benign
Transcript: ENSMUST00000089688
SMART Domains Protein: ENSMUSP00000087119
Gene: ENSMUSG00000000957

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:PG_binding_1 36 88 2.1e-12 PFAM
ZnMc 115 285 6.01e-58 SMART
HX 323 366 3.97e-9 SMART
HX 368 412 1.42e-10 SMART
HX 415 461 4.45e-12 SMART
HX 463 508 1.61e-9 SMART
Pfam:DUF3377 512 582 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196155
Predicted Effect probably benign
Transcript: ENSMUST00000197874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197947
Predicted Effect probably benign
Transcript: ENSMUST00000225641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226710
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit craniofacial dysmorphism, arthritis, osteopenia, dwarfism, and fibrosis of soft tissues. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations may lead to postnatal or premature death, craniofacial anomalies, skeletal dysplasia, low body weight, reduced bone formation and chondrocyte proliferation, arthritis, and fibrosis as well as defects in angiogenesis and lung, tooth,kidney, and submaxillary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Mmp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Mmp14 APN 14 54435790 missense possibly damaging 0.60
IGL01937:Mmp14 APN 14 54437596 splice site probably benign
IGL02565:Mmp14 APN 14 54440557 missense probably benign 0.02
cartoon UTSW 14 54439999 missense probably damaging 0.96
mumping UTSW 14 54439412 missense probably damaging 1.00
IGL03134:Mmp14 UTSW 14 54439106 missense probably damaging 1.00
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0538:Mmp14 UTSW 14 54438709 missense possibly damaging 0.47
R0612:Mmp14 UTSW 14 54440434 missense probably damaging 1.00
R2352:Mmp14 UTSW 14 54440545 missense probably benign 0.30
R3700:Mmp14 UTSW 14 54431932 unclassified probably benign
R4289:Mmp14 UTSW 14 54436208 nonsense probably null
R4888:Mmp14 UTSW 14 54436205 missense probably damaging 0.98
R5068:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5069:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5070:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5216:Mmp14 UTSW 14 54437663 missense possibly damaging 0.82
R5607:Mmp14 UTSW 14 54439412 missense probably damaging 1.00
R6053:Mmp14 UTSW 14 54435890 missense probably benign 0.39
R6477:Mmp14 UTSW 14 54437658 missense probably damaging 1.00
R7153:Mmp14 UTSW 14 54436251 missense possibly damaging 0.93
R7212:Mmp14 UTSW 14 54435879 missense probably damaging 1.00
R7555:Mmp14 UTSW 14 54437742 missense possibly damaging 0.96
R7957:Mmp14 UTSW 14 54436250 missense probably benign 0.01
R8263:Mmp14 UTSW 14 54435787 missense probably damaging 1.00
R8409:Mmp14 UTSW 14 54440668 missense probably damaging 1.00
RF003:Mmp14 UTSW 14 54439014 nonsense probably null
X0064:Mmp14 UTSW 14 54431946 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGTTGGACACACCCACGC -3'
(R):5'- ACATCTCTCCTCGGAGCATGGC -3'

Sequencing Primer
(F):5'- gtgtccacagagaccagag -3'
(R):5'- GCCACGGTGTCAAAGTTC -3'
Posted On2014-08-06