Mutagenetix > Incidental Mutations

Incidental Mutation 'R0053:Cblb'

218418

Institutional Source

Beutler Lab

Gene Symbol

Cblb

Ensembl Gene

ENSMUSG00000022637

Gene Name

Casitas B-lineage lymphoma b

Synonyms

Cbl-b

MMRRC Submission

038347-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R0053 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

52031225-52208048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 52142801 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 369 (T369I)

Ref Sequence

ENSEMBL: ENSMUSP00000153787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]

AlphaFold

Q3TTA7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114471
AA Change: T369I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: T369I

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
Pfam:Cbl_N	41	167	1.5e-58	PFAM
Pfam:Cbl_N2	171	254	2.9e-43	PFAM
SH2	257	354	3.22e0	SMART
RING	373	411	1.04e-7	SMART
low complexity region	447	454	N/A	INTRINSIC
low complexity region	543	567	N/A	INTRINSIC
low complexity region	666	682	N/A	INTRINSIC
low complexity region	773	783	N/A	INTRINSIC
low complexity region	792	804	N/A	INTRINSIC
low complexity region	857	871	N/A	INTRINSIC
UBA	888	925	4.06e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226593
AA Change: T369I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227062
AA Change: T369I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227756
AA Change: T217I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227879
AA Change: T369I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.5066

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.9%
20x: 96.5%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,327,590	D711E	probably benign	Het
5730559C18Rik	C	T	1: 136,227,550	V106I	probably benign	Het
Ada	A	T	2: 163,732,292	V148D	probably damaging	Het
Alpi	T	C	1: 87,098,790	D493G	probably benign	Het
Atp10b	A	G	11: 43,216,564		probably benign	Het
AY761185	A	T	8: 20,944,530		probably benign	Het
BC067074	T	C	13: 113,368,489	W2051R	probably benign	Het
Cadm1	C	T	9: 47,799,414	T205I	probably damaging	Het
Capn3	A	G	2: 120,491,837	I413V	possibly damaging	Het
Ccdc54	T	A	16: 50,590,234	N223I	probably benign	Het
Cdc25c	A	G	18: 34,735,435	V294A	probably benign	Het
Cep170	A	T	1: 176,782,380	S122T	possibly damaging	Het
Chd1	A	G	17: 15,747,189	N849D	probably damaging	Het
Dpp3	A	G	19: 4,923,126	C147R	probably damaging	Het
Dst	A	G	1: 34,294,550		probably null	Het
Fbxw9	T	A	8: 85,064,454	L250Q	probably damaging	Het
Gpr75	A	T	11: 30,892,571	Q492L	possibly damaging	Het
Gramd4	T	A	15: 86,130,138		probably benign	Het
Hivep2	T	C	10: 14,132,121	C1488R	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Insr	A	G	8: 3,155,683	S1369P	probably damaging	Het
Insrr	A	C	3: 87,800,452	D67A	probably damaging	Het
Irf2	T	A	8: 46,818,851	Y158N	probably benign	Het
Katnbl1	A	G	2: 112,404,241	R23G	probably benign	Het
Lamb2	T	A	9: 108,486,737	C987*	probably null	Het
Lzts2	T	C	19: 45,026,307		probably benign	Het
Mmp14	T	A	14: 54,438,652		probably benign	Het
Mycbpap	A	G	11: 94,511,736	Y258H	probably damaging	Het
Nav3	A	G	10: 109,766,917		probably benign	Het
Olfr1186	T	A	2: 88,526,163	N193K	probably damaging	Het
Olfr1406	T	C	1: 173,184,278	D52G	probably benign	Het
Parp10	T	A	15: 76,242,246	L247F	probably damaging	Het
Pcsk6	C	T	7: 65,983,703		probably benign	Het
Pgap3	A	T	11: 98,391,098	V129D	probably benign	Het
Pibf1	A	G	14: 99,140,557	Y373C	probably damaging	Het
Plcb1	A	G	2: 135,294,915	E310G	probably benign	Het
Plin3	T	C	17: 56,279,892	D385G	probably damaging	Het
Pole	A	T	5: 110,293,340	D220V	probably damaging	Het
Ptprk	T	A	10: 28,475,109	F533I	probably damaging	Het
Rufy1	A	T	11: 50,401,465	M499K	probably benign	Het
Scn1a	T	G	2: 66,299,775	D1232A	probably benign	Het
Sec23ip	T	C	7: 128,745,167	L49P	probably damaging	Het
Sf3b1	G	A	1: 55,000,373	Q698*	probably null	Het
Shprh	A	T	10: 11,194,372		probably null	Het
Snd1	C	A	6: 28,745,335		probably benign	Het
Stab1	C	T	14: 31,140,687	A2260T	possibly damaging	Het
Stpg2	A	G	3: 139,212,321	Q60R	probably benign	Het
Strn	T	C	17: 78,656,934	H687R	possibly damaging	Het
Tgfb3	A	T	12: 86,077,829	I35N	probably damaging	Het
Tnks2	T	C	19: 36,875,365	S166P	probably damaging	Het
Tyw5	G	A	1: 57,401,438	T55M	probably damaging	Het
Usp19	A	G	9: 108,497,170		probably null	Het
Zfp13	A	T	17: 23,576,148	I483N	probably damaging	Het

Other mutations in Cblb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Cblb	APN	16	52183307	missense	probably benign	0.28
IGL00927:Cblb	APN	16	52166098	missense	probably benign
IGL01108:Cblb	APN	16	52047451	critical splice donor site	probably null
IGL01336:Cblb	APN	16	52186229	missense	probably benign	0.00
IGL01943:Cblb	APN	16	52139633	splice site	probably null
IGL02273:Cblb	APN	16	52047294	missense	possibly damaging	0.95
IGL02405:Cblb	APN	16	52166253	missense	probably benign	0.32
IGL02445:Cblb	APN	16	52166305	missense	probably damaging	1.00
IGL02728:Cblb	APN	16	52183309	missense	probably benign	0.04
IGL03000:Cblb	APN	16	52204542	missense	probably damaging	1.00
PIT4362001:Cblb	UTSW	16	52139542	nonsense	probably null
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0294:Cblb	UTSW	16	52135824	missense	probably damaging	1.00
R0403:Cblb	UTSW	16	52152626	missense	probably benign	0.23
R0506:Cblb	UTSW	16	52204480	missense	probably benign	0.25
R1172:Cblb	UTSW	16	52186240	splice site	probably benign
R1245:Cblb	UTSW	16	52047187	splice site	probably benign
R1443:Cblb	UTSW	16	52139611	missense	possibly damaging	0.95
R1549:Cblb	UTSW	16	52033010	splice site	probably benign
R1568:Cblb	UTSW	16	52135829	missense	probably damaging	1.00
R1734:Cblb	UTSW	16	52186240	splice site	probably benign
R2107:Cblb	UTSW	16	52152716	critical splice donor site	probably null
R2231:Cblb	UTSW	16	52194272	missense	probably benign	0.00
R4419:Cblb	UTSW	16	52047258	missense	possibly damaging	0.80
R4913:Cblb	UTSW	16	52166029	missense	possibly damaging	0.78
R4940:Cblb	UTSW	16	52033103	missense	probably damaging	1.00
R5159:Cblb	UTSW	16	52112120	missense	probably damaging	0.97
R5318:Cblb	UTSW	16	52186198	missense	possibly damaging	0.88
R5367:Cblb	UTSW	16	52204653	missense	probably damaging	1.00
R5432:Cblb	UTSW	16	52142865	missense	probably damaging	1.00
R5490:Cblb	UTSW	16	52174370	missense	possibly damaging	0.52
R5618:Cblb	UTSW	16	52152668	missense	possibly damaging	0.89
R6047:Cblb	UTSW	16	52112248	critical splice donor site	probably null
R6152:Cblb	UTSW	16	52141056	missense	probably damaging	0.98
R6667:Cblb	UTSW	16	52152644	missense	possibly damaging	0.81
R6914:Cblb	UTSW	16	52047430	missense	probably damaging	1.00
R7681:Cblb	UTSW	16	52204638	missense	probably damaging	0.96
R7940:Cblb	UTSW	16	52152536	missense	probably damaging	1.00
R8167:Cblb	UTSW	16	52166002	missense	probably benign	0.13
R8236:Cblb	UTSW	16	52166029	missense	possibly damaging	0.85
R8494:Cblb	UTSW	16	52204640	missense	probably damaging	1.00
R8880:Cblb	UTSW	16	52166005	missense	probably benign
R9308:Cblb	UTSW	16	52189011	critical splice acceptor site	probably null
R9386:Cblb	UTSW	16	52166338	nonsense	probably null
R9387:Cblb	UTSW	16	52033152	missense	probably benign	0.12
X0011:Cblb	UTSW	16	52152629	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCTTCGTCCTCAGATTCCTAAAGATGC -3'
(R):5'- TCCTGAGTCAGTAAGATGTGGAAGGC -3'

Sequencing Primer
(F):5'- gaaaacaagaaaaaaagaaaagaCCG -3'
(R):5'- CTGAGAGGGGAAGTGTGAAC -3'

Posted On

2014-08-06