Incidental Mutation 'R0134:Hes1'
ID21842
Institutional Source Beutler Lab
Gene Symbol Hes1
Ensembl Gene ENSMUSG00000022528
Gene Namehes family bHLH transcription factor 1
SynonymsHry, bHLHb39
MMRRC Submission 038419-MU
Accession Numbers

Genbank: NM_008235.2

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0134 (G1)
Quality Score174
Status Validated
Chromosome16
Chromosomal Location30064384-30067796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30067250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 224 (V224A)
Ref Sequence ENSEMBL: ENSMUSP00000023171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023171]
Predicted Effect probably damaging
Transcript: ENSMUST00000023171
AA Change: V224A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023171
Gene: ENSMUSG00000022528
AA Change: V224A

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
HLH 40 97 6.51e-14 SMART
ORANGE 108 152 1.71e-18 SMART
low complexity region 156 204 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161839
Meta Mutation Damage Score 0.3077 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show anomalous timing in neurogenesis. Homozygotes for a null allele exhibit premature neurogenesis, severe neural tube defects, supernumerary hair cells in the inner ear, increased numbers of pulmonary neuroendocrine cells, and pancreatic hypoplasia. Death occurs in utero or neonatally. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Hes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Hes1 APN 16 30066158 splice site probably benign
IGL02010:Hes1 APN 16 30067310 missense probably damaging 1.00
I2289:Hes1 UTSW 16 30065881 missense probably damaging 1.00
R1070:Hes1 UTSW 16 30067283 missense probably damaging 0.98
R6385:Hes1 UTSW 16 30065606 missense possibly damaging 0.50
R6950:Hes1 UTSW 16 30067271 missense probably damaging 1.00
R7354:Hes1 UTSW 16 30065928 critical splice donor site probably null
R7744:Hes1 UTSW 16 30066179 missense probably damaging 1.00
R8237:Hes1 UTSW 16 30067229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCAGCGAGTGCATGAACGAGG -3'
(R):5'- CAAATGCAGTGCATGGTCAGTCAC -3'

Sequencing Primer
(F):5'- TGTGAGGGCGTTAACACC -3'
(R):5'- GCATGGTCAGTCACTTAATACAGC -3'
Posted On2013-04-12