Incidental Mutation 'R0589:Camk2a'
ID218424
Institutional Source Beutler Lab
Gene Symbol Camk2a
Ensembl Gene ENSMUSG00000024617
Gene Namecalcium/calmodulin-dependent protein kinase II alpha
Synonymsalpha-CaMKII
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0589 (G1)
Quality Score28
Status Validated
Chromosome18
Chromosomal Location60925618-60988152 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 60963964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025519] [ENSMUST00000039904] [ENSMUST00000102888] [ENSMUST00000115295]
Predicted Effect probably null
Transcript: ENSMUST00000025519
SMART Domains Protein: ENSMUSP00000025519
Gene: ENSMUSG00000024617

DomainStartEndE-ValueType
S_TKc 13 271 3.59e-107 SMART
low complexity region 314 344 N/A INTRINSIC
Pfam:CaMKII_AD 357 484 6.7e-68 PFAM
Pfam:DUF4440 361 475 2.6e-10 PFAM
Pfam:SnoaL_3 361 485 6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039904
SMART Domains Protein: ENSMUSP00000048325
Gene: ENSMUSG00000024617

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:CaMKII_AD 57 184 1.1e-67 PFAM
Pfam:DUF4440 61 175 1e-12 PFAM
Pfam:SnoaL_3 61 185 4.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102888
SMART Domains Protein: ENSMUSP00000099952
Gene: ENSMUSG00000024617

DomainStartEndE-ValueType
S_TKc 13 271 3.59e-107 SMART
low complexity region 314 324 N/A INTRINSIC
Pfam:CaMKII_AD 346 473 1.2e-66 PFAM
Pfam:DUF4440 350 464 4.5e-12 PFAM
Pfam:SnoaL_3 350 474 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115295
SMART Domains Protein: ENSMUSP00000110950
Gene: ENSMUSG00000024617

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:CaMKII_AD 68 195 3.8e-67 PFAM
Pfam:DUF4440 72 186 1.7e-12 PFAM
Pfam:SnoaL_3 72 196 9.5e-13 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinases family, and to the Ca(2+)/calmodulin-dependent protein kinases subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. This calcium calmodulin-dependent protein kinase is composed of four different chains: alpha, beta, gamma, and delta. The alpha chain encoded by this gene is required for hippocampal long-term potentiation (LTP) and spatial learning. In addition to its calcium-calmodulin (CaM)-dependent activity, this protein can undergo autophosphorylation, resulting in CaM-independent activity. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous targeted mutants display deficient long-term hippocampal potentiation (LTP) and specific impairment in spatial learning; heterozygotes show decreased fear response and increased defensive aggression, which is more pronounced in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Camk2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Camk2a APN 18 60980156 critical splice donor site probably null
IGL01707:Camk2a APN 18 60960050 splice site probably null
IGL02117:Camk2a APN 18 60977989 missense probably damaging 0.99
frantic UTSW 18 60963928 nonsense probably null
R0003:Camk2a UTSW 18 60960007 missense probably damaging 0.99
R0373:Camk2a UTSW 18 60958238 missense probably damaging 0.98
R1135:Camk2a UTSW 18 60957396 critical splice donor site probably null
R1199:Camk2a UTSW 18 60952324 nonsense probably null
R2159:Camk2a UTSW 18 60957185 missense probably damaging 1.00
R2291:Camk2a UTSW 18 60963959 missense probably damaging 1.00
R4022:Camk2a UTSW 18 60963928 nonsense probably null
R4662:Camk2a UTSW 18 60941339 missense probably damaging 1.00
R4664:Camk2a UTSW 18 60955624 missense possibly damaging 0.91
R4859:Camk2a UTSW 18 60943174 intron probably benign
R5119:Camk2a UTSW 18 60943136 intron probably benign
R5291:Camk2a UTSW 18 60957164 missense probably damaging 1.00
R5503:Camk2a UTSW 18 60978000 missense probably damaging 0.99
R5874:Camk2a UTSW 18 60943200 intron probably benign
R5997:Camk2a UTSW 18 60977957 missense probably damaging 1.00
R6109:Camk2a UTSW 18 60943234 nonsense probably null
R6772:Camk2a UTSW 18 60969020 missense probably benign 0.21
R6939:Camk2a UTSW 18 60958154 missense probably damaging 1.00
R6977:Camk2a UTSW 18 60960004 missense probably damaging 1.00
R6993:Camk2a UTSW 18 60943175 intron probably benign
R7247:Camk2a UTSW 18 60943205 missense unknown
R7625:Camk2a UTSW 18 60952340 missense probably damaging 0.97
R7900:Camk2a UTSW 18 60957366 missense probably damaging 1.00
R7983:Camk2a UTSW 18 60957366 missense probably damaging 1.00
X0020:Camk2a UTSW 18 60960037 missense possibly damaging 0.89
X0026:Camk2a UTSW 18 60952136 missense possibly damaging 0.87
Z1088:Camk2a UTSW 18 60943150 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTCTCGCTGGTTGCCAAG -3'
(R):5'- TGCACAGTTTTCCAGCCCCATAG -3'

Sequencing Primer
(F):5'- TTGCCAAGCCAGCTCTG -3'
(R):5'- GATCTGCCCTCCTCAAGATCTG -3'
Posted On2014-08-07