Incidental Mutation 'R0134:Dele1'
ID 21843
Institutional Source Beutler Lab
Gene Symbol Dele1
Ensembl Gene ENSMUSG00000024442
Gene Name DAP3 binding cell death enhancer 1
Synonyms 0610009O20Rik
MMRRC Submission 038419-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R0134 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 18
Chromosomal Location 38383302-38395682 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38394317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 505 (V505I)
Ref Sequence ENSEMBL: ENSMUSP00000025314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025314]
AlphaFold Q9DCV6
Predicted Effect probably benign
Transcript: ENSMUST00000025314
AA Change: V505I

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025314
Gene: ENSMUSG00000024442
AA Change: V505I

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
low complexity region 127 140 N/A INTRINSIC
SEL1 244 277 1.53e2 SMART
SEL1 278 313 2.8e-9 SMART
SEL1 314 351 3.3e1 SMART
SEL1 352 385 1.31e0 SMART
SEL1 386 421 1.67e-7 SMART
Meta Mutation Damage Score 0.1251 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,575,565 (GRCm39) probably benign Het
Abca16 T A 7: 120,139,378 (GRCm39) L1470Q probably damaging Het
Arhgap23 G T 11: 97,335,154 (GRCm39) V70L probably benign Het
Bicd1 T C 6: 149,414,448 (GRCm39) I387T probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
Cd59b G A 2: 103,909,286 (GRCm39) probably null Het
Ddx50 A T 10: 62,457,156 (GRCm39) probably benign Het
Dnlz T C 2: 26,241,380 (GRCm39) N116S probably damaging Het
Efcab14 T C 4: 115,597,728 (GRCm39) F108L probably damaging Het
Esyt2 A G 12: 116,331,330 (GRCm39) N736S probably damaging Het
Exoc4 A G 6: 33,948,881 (GRCm39) D908G possibly damaging Het
Garnl3 T C 2: 32,896,816 (GRCm39) T608A possibly damaging Het
Hdac2 T A 10: 36,865,180 (GRCm39) D131E probably benign Het
Hes1 T C 16: 29,886,068 (GRCm39) V224A probably damaging Het
Hps1 G T 19: 42,754,619 (GRCm39) Q277K probably damaging Het
Ighv15-2 T G 12: 114,528,657 (GRCm39) probably benign Het
Il3 A G 11: 54,156,506 (GRCm39) probably null Het
Itgae A C 11: 73,002,168 (GRCm39) M91L probably benign Het
Kctd21 T A 7: 96,997,298 (GRCm39) I257N probably benign Het
Kif16b A T 2: 142,514,295 (GRCm39) S1215T probably benign Het
Lhx9 A T 1: 138,766,417 (GRCm39) C124S probably damaging Het
Lipo4 A G 19: 33,479,006 (GRCm39) V278A probably benign Het
Lrp1b T C 2: 40,486,995 (GRCm39) E142G probably damaging Het
Macf1 T C 4: 123,326,636 (GRCm39) M2835V possibly damaging Het
Map9 G A 3: 82,267,290 (GRCm39) probably benign Het
Miox C T 15: 89,218,657 (GRCm39) probably benign Het
Mndal A T 1: 173,685,079 (GRCm39) probably benign Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nepn A T 10: 52,276,533 (GRCm39) T29S probably damaging Het
Nlgn1 C T 3: 25,490,089 (GRCm39) C546Y probably damaging Het
Or14a260 A G 7: 85,984,803 (GRCm39) I267T probably benign Het
Or8k53 T C 2: 86,178,072 (GRCm39) I13V possibly damaging Het
Pdgfra A G 5: 75,327,172 (GRCm39) D123G probably damaging Het
Plekhn1 T C 4: 156,312,700 (GRCm39) R53G probably benign Het
Pnp2 T C 14: 51,200,634 (GRCm39) F100S probably damaging Het
Prickle1 A G 15: 93,408,658 (GRCm39) L47P possibly damaging Het
Ptar1 T A 19: 23,695,459 (GRCm39) C309S probably benign Het
Rimoc1 T C 15: 4,015,776 (GRCm39) K263E probably damaging Het
Rxfp1 A G 3: 79,564,783 (GRCm39) S327P probably damaging Het
Siah2 A G 3: 58,583,536 (GRCm39) V250A probably damaging Het
Siglecg G A 7: 43,060,595 (GRCm39) G325D probably damaging Het
Slc10a7 T A 8: 79,423,787 (GRCm39) probably null Het
Slc9a1 A G 4: 133,147,916 (GRCm39) K645E probably benign Het
Smarca4 T C 9: 21,548,620 (GRCm39) L302P probably damaging Het
Smyd1 G T 6: 71,193,749 (GRCm39) T392N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tenm3 A T 8: 49,127,507 (GRCm39) L57Q probably damaging Het
Tep1 C T 14: 51,067,150 (GRCm39) V2269I possibly damaging Het
Tpd52l1 A G 10: 31,255,252 (GRCm39) S32P probably damaging Het
Tsfm A G 10: 126,858,798 (GRCm39) probably benign Het
Ttn C A 2: 76,623,474 (GRCm39) V15368L possibly damaging Het
Ttn T A 2: 76,540,468 (GRCm39) R34173W probably damaging Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vps13b T C 15: 35,887,407 (GRCm39) I3272T probably benign Het
Zfp108 A G 7: 23,959,892 (GRCm39) H161R probably benign Het
Zfp518b A G 5: 38,832,002 (GRCm39) M1T probably null Het
Other mutations in Dele1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Dele1 APN 18 38,385,913 (GRCm39) missense probably damaging 0.96
IGL02456:Dele1 APN 18 38,394,177 (GRCm39) missense probably damaging 1.00
R0225:Dele1 UTSW 18 38,394,317 (GRCm39) missense probably benign 0.37
R0511:Dele1 UTSW 18 38,387,124 (GRCm39) critical splice donor site probably null
R0560:Dele1 UTSW 18 38,387,551 (GRCm39) missense probably damaging 1.00
R1899:Dele1 UTSW 18 38,391,395 (GRCm39) missense probably benign 0.04
R3005:Dele1 UTSW 18 38,393,012 (GRCm39) missense possibly damaging 0.92
R3552:Dele1 UTSW 18 38,391,418 (GRCm39) splice site probably benign
R4418:Dele1 UTSW 18 38,394,340 (GRCm39) critical splice donor site probably null
R7448:Dele1 UTSW 18 38,390,319 (GRCm39) missense probably damaging 1.00
R7671:Dele1 UTSW 18 38,392,978 (GRCm39) missense probably damaging 0.99
R9126:Dele1 UTSW 18 38,384,210 (GRCm39) missense probably benign
R9294:Dele1 UTSW 18 38,394,129 (GRCm39) missense probably damaging 1.00
Z1177:Dele1 UTSW 18 38,387,356 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGATGATTGAGCATTGCTGTCAC -3'
(R):5'- AGTCACCGATTAGCCATGCACTG -3'

Sequencing Primer
(F):5'- GACAGGACTGAAGTCTTTCTCCAG -3'
(R):5'- CGATTAGCCATGCACTGGAAATAG -3'
Posted On 2013-04-12