Incidental Mutation 'R0021:Ptprk'
ID218434
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0021 (G1)
Quality Score33
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28592895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1425 (V1425E)
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: V1437E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: V1437E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: V1451E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: V1425E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220404
Meta Mutation Damage Score 0.8937 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGTGTCCTTTCCCAGGAGAGTGTG -3'
(R):5'- TTCTTCACCCAACAGGTTATGTGATGG -3'

Sequencing Primer
(F):5'- CCCAGGAGAGTGTGATGGTG -3'
(R):5'- TGCATTTATACAGGCAAAGCCAG -3'
Posted On2014-08-08