Incidental Mutation 'R0021:Tbc1d10a'
ID218437
Institutional Source Beutler Lab
Gene Symbol Tbc1d10a
Ensembl Gene ENSMUSG00000034412
Gene NameTBC1 domain family, member 10a
SynonymsTbc1d10, EPI64
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0021 (G1)
Quality Score22
Status Validated
Chromosome11
Chromosomal Location4186789-4215505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4213680 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 277 (C277R)
Ref Sequence ENSEMBL: ENSMUSP00000136453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020699] [ENSMUST00000041042] [ENSMUST00000180088]
Predicted Effect probably benign
Transcript: ENSMUST00000020699
SMART Domains Protein: ENSMUSP00000020699
Gene: ENSMUSG00000020424

DomainStartEndE-ValueType
Pfam:ACT_7 71 138 1.3e-19 PFAM
Pfam:ACT_7 257 321 3.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041042
AA Change: C311R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036861
Gene: ENSMUSG00000034412
AA Change: C311R

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
TBC 142 359 6e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151672
Predicted Effect probably damaging
Transcript: ENSMUST00000180088
AA Change: C277R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136453
Gene: ENSMUSG00000034412
AA Change: C277R

DomainStartEndE-ValueType
TBC 108 325 6e-59 SMART
Meta Mutation Damage Score 0.9673 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating LDL cholesterol levels, decreased circulating alanine transaminase and alkaline phosphatase levels, abnormal liver physiology, and increased chromosomal stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Tbc1d10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Tbc1d10a APN 11 4212826 missense probably benign 0.14
IGL02354:Tbc1d10a APN 11 4215047 missense probably benign 0.00
IGL02361:Tbc1d10a APN 11 4215047 missense probably benign 0.00
IGL03382:Tbc1d10a APN 11 4209984 missense probably damaging 1.00
R0021:Tbc1d10a UTSW 11 4213680 missense probably damaging 1.00
R0194:Tbc1d10a UTSW 11 4212901 critical splice donor site probably null
R0383:Tbc1d10a UTSW 11 4212819 missense probably damaging 0.98
R7388:Tbc1d10a UTSW 11 4205858 critical splice donor site probably null
R7432:Tbc1d10a UTSW 11 4213016 nonsense probably null
R7811:Tbc1d10a UTSW 11 4186948 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTGGGACACTCAGCCCCATTG -3'
(R):5'- CCACGCGGAAGATGATCTTGACTC -3'

Sequencing Primer
(F):5'- CCATGTTGGCCCAGTACTAAGAG -3'
(R):5'- GGAAGATGATCTTGACTCCTGTATG -3'
Posted On2014-08-08