Incidental Mutation 'R0021:Btnl1'
ID 218443
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission 038316-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0021 (G1)
Quality Score 72
Status Validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34598468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 28 (E28G)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably benign
Transcript: ENSMUST00000080254
AA Change: E28G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: E28G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,326,620 (GRCm39) noncoding transcript Het
Abcc5 T A 16: 20,197,411 (GRCm39) K647* probably null Het
Aplp1 A G 7: 30,135,241 (GRCm39) probably benign Het
Arhgef25 A G 10: 127,025,423 (GRCm39) I43T probably benign Het
Brinp3 T G 1: 146,777,189 (GRCm39) S545R probably benign Het
C5ar2 A G 7: 15,971,601 (GRCm39) F109L probably benign Het
D630045J12Rik G A 6: 38,160,902 (GRCm39) Q1081* probably null Het
Dhx36 T C 3: 62,385,016 (GRCm39) I699V possibly damaging Het
Dnah9 A G 11: 65,860,805 (GRCm39) I2855T probably benign Het
Dock8 T C 19: 25,140,411 (GRCm39) I1317T probably benign Het
Galnt11 A T 5: 25,453,855 (GRCm39) D27V probably damaging Het
Gm5134 T A 10: 75,829,718 (GRCm39) C335S probably damaging Het
Hdhd2 A T 18: 77,058,311 (GRCm39) K227N probably damaging Het
Impg1 A T 9: 80,317,479 (GRCm39) L36Q probably damaging Het
Krtcap3 A G 5: 31,410,303 (GRCm39) H227R probably benign Het
Lrrc7 A G 3: 157,866,298 (GRCm39) Y1148H probably damaging Het
Map2k4 A G 11: 65,603,110 (GRCm39) I174T probably damaging Het
Mef2c C A 13: 83,804,359 (GRCm39) L282M probably damaging Het
Nkapd1 A C 9: 50,521,725 (GRCm39) D65E probably damaging Het
Nqo2 T C 13: 34,165,490 (GRCm39) I129T probably benign Het
Pdgfrb T A 18: 61,197,998 (GRCm39) probably benign Het
Phf7 C T 14: 30,960,443 (GRCm39) probably benign Het
Plac8 T A 5: 100,704,434 (GRCm39) T88S probably benign Het
Pou2f1 G A 1: 165,703,587 (GRCm39) T654M probably damaging Het
Ptprk T A 10: 28,468,891 (GRCm39) V1425E probably damaging Het
Saal1 A T 7: 46,342,316 (GRCm39) S376T probably damaging Het
Scart2 G A 7: 139,876,310 (GRCm39) R594H probably benign Het
Serpini1 T C 3: 75,526,620 (GRCm39) Y291H probably damaging Het
Siah2 T C 3: 58,583,713 (GRCm39) H191R probably benign Het
Spaca6 T A 17: 18,058,498 (GRCm39) Y39* probably null Het
Tbc1d10a T C 11: 4,163,680 (GRCm39) C277R probably damaging Het
Trim45 A T 3: 100,832,736 (GRCm39) D323V probably damaging Het
Trim55 A C 3: 19,698,866 (GRCm39) M32L probably benign Het
Unc5b T C 10: 60,614,698 (GRCm39) T200A probably benign Het
Uqcc4 A G 17: 25,403,957 (GRCm39) E99G possibly damaging Het
V1rd19 A T 7: 23,703,029 (GRCm39) D165V probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0371:Btnl1 UTSW 17 34,600,031 (GRCm39) missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34,598,578 (GRCm39) missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34,604,608 (GRCm39) missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34,598,725 (GRCm39) missense probably null 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34,600,118 (GRCm39) missense probably benign 0.00
R9528:Btnl1 UTSW 17 34,603,352 (GRCm39) missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGACACTCCTAGCTCAGAACACC -3'
(R):5'- TTGTGGAACACCAGCACAGCAG -3'

Sequencing Primer
(F):5'- cccctctctccttccctc -3'
(R):5'- CAGCACAGCAGGGGTGG -3'
Posted On 2014-08-08