Incidental Mutation 'R0021:Btnl1'
ID 218443
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms Btnl3, LOC240074, LOC240074, NG10
MMRRC Submission 038316-MU
Accession Numbers

Genbank: NM_001111094; MGI: 1932027

Essential gene? Non essential (E-score: 0.000) question?
Stock # R0021 (G1)
Quality Score 72
Status Validated
Chromosome 17
Chromosomal Location 34377132-34385776 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34379494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 28 (E28G)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably benign
Transcript: ENSMUST00000080254
AA Change: E28G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: E28G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34381117 missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34385685 missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34379535 missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34382265 missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34385512 missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34381056 missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0371:Btnl1 UTSW 17 34381057 missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34381208 nonsense probably null
R1982:Btnl1 UTSW 17 34379751 missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34379604 missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34385634 missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34381038 missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34381159 missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34382462 missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34379725 missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34379751 missense probably null 0.99
R5579:Btnl1 UTSW 17 34381552 critical splice donor site probably null
R5811:Btnl1 UTSW 17 34385529 missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R6602:Btnl1 UTSW 17 34385748 missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34385331 missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34385673 missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34380040 splice site probably null
R8840:Btnl1 UTSW 17 34385603 missense probably benign 0.17
R9120:Btnl1 UTSW 17 34379707 missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34381144 missense probably benign 0.00
R9528:Btnl1 UTSW 17 34384378 missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34384361 missense probably benign 0.16
RF041:Btnl1 UTSW 17 34381368 missense probably benign 0.04
X0026:Btnl1 UTSW 17 34377932 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGACACTCCTAGCTCAGAACACC -3'
(R):5'- TTGTGGAACACCAGCACAGCAG -3'

Sequencing Primer
(F):5'- cccctctctccttccctc -3'
(R):5'- CAGCACAGCAGGGGTGG -3'
Posted On 2014-08-08