Incidental Mutation 'R0021:Hdhd2'
ID218444
Institutional Source Beutler Lab
Gene Symbol Hdhd2
Ensembl Gene ENSMUSG00000025421
Gene Namehaloacid dehalogenase-like hydrolase domain containing 2
Synonyms0610039H12Rik, 3110052N05Rik
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0021 (G1)
Quality Score24
Status Validated
Chromosome18
Chromosomal Location76930126-76972902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76970615 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 227 (K227N)
Ref Sequence ENSEMBL: ENSMUSP00000114212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026485] [ENSMUST00000097522] [ENSMUST00000142456] [ENSMUST00000145634] [ENSMUST00000148955] [ENSMUST00000150990]
PDB Structure
Crystal Structure of Protein from Mouse Mm.236127 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026485
AA Change: K227N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026485
Gene: ENSMUSG00000025421
AA Change: K227N

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.1e-21 PFAM
Pfam:HAD_2 167 223 1e-7 PFAM
Pfam:Hydrolase_like 176 251 3.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097522
AA Change: K227N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095129
Gene: ENSMUSG00000025421
AA Change: K227N

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142456
SMART Domains Protein: ENSMUSP00000118504
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Yos1 5 66 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145634
AA Change: K227N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123320
Gene: ENSMUSG00000025421
AA Change: K227N

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148955
AA Change: K227N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421
AA Change: K227N

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150990
AA Change: K227N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421
AA Change: K227N

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Meta Mutation Damage Score 0.7026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a transposon insertion results in complete embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Hdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Hdhd2 APN 18 76965273 splice site probably null
IGL01102:Hdhd2 APN 18 76956911 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0717:Hdhd2 UTSW 18 76951204 missense possibly damaging 0.94
R1958:Hdhd2 UTSW 18 76965145 missense probably benign
R2060:Hdhd2 UTSW 18 76965042 splice site probably null
R2266:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2268:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2269:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2873:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R3788:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R3789:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R5784:Hdhd2 UTSW 18 76967145 missense probably damaging 1.00
R7403:Hdhd2 UTSW 18 76955040 missense probably benign 0.00
R7406:Hdhd2 UTSW 18 76944115 missense probably benign 0.01
R7644:Hdhd2 UTSW 18 76944175 missense possibly damaging 0.79
R7849:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
R7932:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCACCGTTGTCTGGATTGC -3'
(R):5'- TTCACGGCTCAACTCTGGCATC -3'

Sequencing Primer
(F):5'- GGATTGCTCCTTTACCTCCTGAG -3'
(R):5'- TGAGTCAGTCATGCTCACAG -3'
Posted On2014-08-08