Incidental Mutation 'R0050:Gm11492'
ID 218464
Institutional Source Beutler Lab
Gene Symbol Gm11492
Ensembl Gene ENSMUSG00000090107
Gene Name predicted gene 11492
Synonyms
MMRRC Submission 038344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R0050 (G1)
Quality Score 46
Status Validated
Chromosome 11
Chromosomal Location 87566653-87569250 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87567346 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 182 (L182S)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060360
AA Change: L182S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: L182S

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Meta Mutation Damage Score 0.1480 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C T 11: 110,145,591 C564Y probably damaging Het
Adamts2 T C 11: 50,775,395 V406A probably damaging Het
Ankar T A 1: 72,656,164 E1093D probably damaging Het
Arhgef38 C A 3: 133,132,196 D75Y probably damaging Het
Atg4b T A 1: 93,787,718 probably benign Het
Cadm2 A G 16: 66,953,266 probably benign Het
Ces2c T A 8: 104,848,199 M96K probably benign Het
Dmrt3 C A 19: 25,622,589 P266H probably damaging Het
Dock9 A G 14: 121,607,225 V1124A probably benign Het
Edem1 T C 6: 108,828,848 F37L possibly damaging Het
Ermp1 C A 19: 29,628,784 A190S probably damaging Het
Gm10267 T A 18: 44,156,453 probably benign Het
Golga2 T A 2: 32,292,127 V29D probably damaging Het
Gprc6a T A 10: 51,615,389 M755L probably damaging Het
H1foo G T 6: 115,947,768 K78N probably damaging Het
Lama3 T A 18: 12,404,103 H268Q probably damaging Het
Lrriq1 A G 10: 103,068,931 V1614A probably damaging Het
Oaz2 A G 9: 65,687,802 E61G probably damaging Het
Pear1 G T 3: 87,755,987 Y441* probably null Het
Pkhd1l1 A T 15: 44,573,807 T3493S possibly damaging Het
Plekhg5 T C 4: 152,108,088 probably null Het
Ppp3cb A G 14: 20,531,752 V65A possibly damaging Het
Rheb A T 5: 24,817,834 probably benign Het
Ros1 G A 10: 52,101,803 T1449M probably damaging Het
Slc6a12 T C 6: 121,360,419 probably benign Het
Stx2 A G 5: 128,999,508 probably null Het
Tnxb T A 17: 34,673,325 D764E probably damaging Het
Trmt2a A T 16: 18,250,843 E234D probably damaging Het
Other mutations in Gm11492
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gm11492 APN 11 87568249 missense probably benign 0.07
IGL01993:Gm11492 APN 11 87567729 missense possibly damaging 0.85
IGL02566:Gm11492 APN 11 87567642 missense probably benign 0.00
IGL03213:Gm11492 APN 11 87567358 splice site probably null
IGL03388:Gm11492 APN 11 87568216 nonsense probably null
R1479:Gm11492 UTSW 11 87567418 missense probably damaging 1.00
R1851:Gm11492 UTSW 11 87568915 missense probably damaging 1.00
R1862:Gm11492 UTSW 11 87567235 missense possibly damaging 0.48
R1913:Gm11492 UTSW 11 87567012 missense probably benign
R3149:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3176:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3276:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R4021:Gm11492 UTSW 11 87567280 missense probably damaging 1.00
R4117:Gm11492 UTSW 11 87568282 missense probably damaging 1.00
R4332:Gm11492 UTSW 11 87567904 missense possibly damaging 0.95
R4515:Gm11492 UTSW 11 87568057 missense probably benign
R4663:Gm11492 UTSW 11 87567603 missense probably damaging 0.98
R4952:Gm11492 UTSW 11 87567772 missense probably benign 0.00
R5015:Gm11492 UTSW 11 87567217 missense possibly damaging 0.95
R5176:Gm11492 UTSW 11 87567532 missense probably benign 0.02
R5711:Gm11492 UTSW 11 87567897 missense probably benign 0.07
R6305:Gm11492 UTSW 11 87567319 missense probably benign 0.00
R9289:Gm11492 UTSW 11 87568966 nonsense probably null
T0970:Gm11492 UTSW 11 87567732 missense probably damaging 0.98
Z1177:Gm11492 UTSW 11 87567922 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATAGAGGTGCCCTGCCATCAC -3'
(R):5'- TGCGAATGCCATGCTCTTGGAC -3'

Sequencing Primer
(F):5'- actctcctcatcactctccac -3'
(R):5'- TCATCCTTCGGGTATGCTGA -3'
Posted On 2014-08-11