Incidental Mutation 'R0685:Sema6c'
ID218477
Institutional Source Beutler Lab
Gene Symbol Sema6c
Ensembl Gene ENSMUSG00000038777
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
SynonymsSema Y, Semay
MMRRC Submission 038870-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R0685 (G1)
Quality Score68
Status Validated
Chromosome3
Chromosomal Location95160457-95174024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95172710 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 772 (C772R)
Ref Sequence ENSEMBL: ENSMUSP00000129081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090821] [ENSMUST00000090823] [ENSMUST00000107217] [ENSMUST00000131620] [ENSMUST00000142449] [ENSMUST00000168321] [ENSMUST00000202315] [ENSMUST00000204709]
Predicted Effect probably benign
Transcript: ENSMUST00000090821
AA Change: C740R

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088331
Gene: ENSMUSG00000038777
AA Change: C740R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090823
AA Change: C772R

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088333
Gene: ENSMUSG00000038777
AA Change: C772R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107217
AA Change: C732R

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102835
Gene: ENSMUSG00000038777
AA Change: C732R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 448 1.23e-126 SMART
low complexity region 551 563 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 652 661 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
low complexity region 899 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130662
Predicted Effect probably benign
Transcript: ENSMUST00000131620
SMART Domains Protein: ENSMUSP00000138154
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141607
Predicted Effect probably benign
Transcript: ENSMUST00000142449
SMART Domains Protein: ENSMUSP00000123457
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168321
AA Change: C772R

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129081
Gene: ENSMUSG00000038777
AA Change: C772R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202315
AA Change: C740R

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144039
Gene: ENSMUSG00000038777
AA Change: C740R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204709
SMART Domains Protein: ENSMUSP00000144702
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
PDB:3OKY|B 25 117 8e-8 PDB
Blast:Sema 62 119 9e-34 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display a decrease in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Sema6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Sema6c APN 3 95172398 missense probably damaging 1.00
IGL01631:Sema6c APN 3 95170403 missense probably benign 0.10
IGL01799:Sema6c APN 3 95170831 missense probably damaging 1.00
IGL02237:Sema6c APN 3 95170119 missense probably damaging 1.00
IGL02852:Sema6c APN 3 95169984 splice site probably benign
IGL02874:Sema6c APN 3 95170377 missense probably damaging 1.00
IGL03003:Sema6c APN 3 95169614 missense probably damaging 1.00
PIT4418001:Sema6c UTSW 3 95170090 missense possibly damaging 0.57
R0558:Sema6c UTSW 3 95168691 missense probably damaging 1.00
R0582:Sema6c UTSW 3 95169197 missense probably damaging 1.00
R0590:Sema6c UTSW 3 95172623 missense probably damaging 1.00
R1056:Sema6c UTSW 3 95171216 missense probably benign 0.15
R1721:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1867:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1868:Sema6c UTSW 3 95170813 missense probably damaging 0.99
R2016:Sema6c UTSW 3 95171234 missense probably benign 0.00
R2343:Sema6c UTSW 3 95167083 missense probably damaging 1.00
R2898:Sema6c UTSW 3 95172818 missense probably damaging 1.00
R4095:Sema6c UTSW 3 95173194 missense probably benign 0.03
R4999:Sema6c UTSW 3 95168363 missense probably damaging 1.00
R5263:Sema6c UTSW 3 95173152 missense probably benign 0.02
R6914:Sema6c UTSW 3 95173208 missense probably benign 0.00
R6942:Sema6c UTSW 3 95173208 missense probably benign 0.00
R7104:Sema6c UTSW 3 95168845 missense possibly damaging 0.95
R7524:Sema6c UTSW 3 95167060 missense probably benign 0.20
R7724:Sema6c UTSW 3 95173199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCATCACCTACCCTAAAGCTG -3'
(R):5'- AGAGGTTCGCTACCCTTCCTGG -3'

Sequencing Primer
(F):5'- CGTCGGAGCAAGGACATC -3'
(R):5'- CTTCCTGGGCGGCTGAG -3'
Posted On2014-08-11