Incidental Mutation 'R0685:Papss1'
ID218478
Institutional Source Beutler Lab
Gene Symbol Papss1
Ensembl Gene ENSMUSG00000028032
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 1
SynonymsAsapk, SK1
MMRRC Submission 038870-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R0685 (G1)
Quality Score54
Status Validated
Chromosome3
Chromosomal Location131564768-131643671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131583093 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 119 (N119H)
Ref Sequence ENSEMBL: ENSMUSP00000142616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029666] [ENSMUST00000196408] [ENSMUST00000196638] [ENSMUST00000197402] [ENSMUST00000199878] [ENSMUST00000200527]
Predicted Effect probably benign
Transcript: ENSMUST00000029666
AA Change: N140H

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029666
Gene: ENSMUSG00000028032
AA Change: N140H

DomainStartEndE-ValueType
Pfam:APS_kinase 51 209 5.6e-78 PFAM
Pfam:AAA_17 54 184 1.7e-7 PFAM
Pfam:AAA_33 55 182 4.4e-9 PFAM
Pfam:PUA_2 225 386 3.3e-51 PFAM
Pfam:ATP-sulfurylase 394 617 7.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196408
Predicted Effect probably benign
Transcript: ENSMUST00000196638
Predicted Effect probably benign
Transcript: ENSMUST00000197402
Predicted Effect possibly damaging
Transcript: ENSMUST00000199878
AA Change: N119H

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142533
Gene: ENSMUSG00000028032
AA Change: N119H

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200527
AA Change: N119H

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142616
Gene: ENSMUSG00000028032
AA Change: N119H

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 [PubMed 10679223]). SULTs catalyze the sulfate conjugation of many endogenous and exogenous compounds, including drugs and other xenobiotics. In humans, PAPS is synthesized from adenosine 5-prime triphosphate (ATP) and inorganic sulfate by 2 isoforms, PAPSS1 and PAPSS2 (MIM 603005).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Papss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Papss1 APN 3 131599949 missense probably benign 0.00
IGL01642:Papss1 APN 3 131583235 splice site probably benign
IGL02249:Papss1 APN 3 131602011 missense probably damaging 1.00
IGL02832:Papss1 APN 3 131582519 missense probably damaging 1.00
IGL03008:Papss1 APN 3 131585099 missense possibly damaging 0.55
IGL03180:Papss1 APN 3 131607382 missense probably damaging 1.00
IGL03343:Papss1 APN 3 131583189 missense probably benign 0.27
IGL03384:Papss1 APN 3 131579352 missense probably damaging 0.96
R0549:Papss1 UTSW 3 131619213 missense possibly damaging 0.87
R0800:Papss1 UTSW 3 131599854 splice site probably benign
R1225:Papss1 UTSW 3 131579301 splice site probably benign
R1458:Papss1 UTSW 3 131605854 missense probably damaging 1.00
R1718:Papss1 UTSW 3 131619185 missense probably damaging 1.00
R1728:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1784:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1862:Papss1 UTSW 3 131583184 missense possibly damaging 0.93
R1937:Papss1 UTSW 3 131599871 missense probably benign 0.38
R2349:Papss1 UTSW 3 131599866 missense probably benign
R3859:Papss1 UTSW 3 131607335 missense probably benign 0.30
R4698:Papss1 UTSW 3 131607331 missense probably damaging 0.97
R4741:Papss1 UTSW 3 131619099 missense probably damaging 1.00
R5333:Papss1 UTSW 3 131643044 missense probably damaging 1.00
R5642:Papss1 UTSW 3 131631804 nonsense probably null
R6658:Papss1 UTSW 3 131605935 missense probably benign
R6932:Papss1 UTSW 3 131599971 missense probably damaging 1.00
R7051:Papss1 UTSW 3 131602050 missense probably damaging 1.00
R7199:Papss1 UTSW 3 131585138 missense probably benign 0.01
R7201:Papss1 UTSW 3 131599926 missense probably damaging 1.00
R7276:Papss1 UTSW 3 131619234 missense probably benign 0.11
R7575:Papss1 UTSW 3 131643096 missense probably damaging 0.99
R7627:Papss1 UTSW 3 131585112 missense probably benign 0.01
R8325:Papss1 UTSW 3 131582611 missense probably benign
R8380:Papss1 UTSW 3 131631695 missense probably damaging 1.00
Z1088:Papss1 UTSW 3 131642967 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGAGCCTTTATGCCATTAGGTGCTG -3'
(R):5'- AAACCTGAAGAAAACGATGCTTGCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAAAACGATGCTTGCCTTTTATCTC -3'
Posted On2014-08-11