Incidental Mutation 'R0685:Bcr'
ID 218483
Institutional Source Beutler Lab
Gene Symbol Bcr
Ensembl Gene ENSMUSG00000009681
Gene Name breakpoint cluster region
Synonyms 5133400C09Rik
MMRRC Submission 038870-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R0685 (G1)
Quality Score 63
Status Validated
Chromosome 10
Chromosomal Location 75060592-75184921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75131643 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 570 (W570R)
Ref Sequence ENSEMBL: ENSMUSP00000126377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164107]
AlphaFold Q6PAJ1
Predicted Effect probably damaging
Transcript: ENSMUST00000164107
AA Change: W570R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126377
Gene: ENSMUSG00000009681
AA Change: W570R

DomainStartEndE-ValueType
Pfam:Bcr-Abl_Oligo 3 75 1.2e-44 PFAM
low complexity region 86 109 N/A INTRINSIC
low complexity region 121 147 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
RhoGEF 501 689 6.22e-51 SMART
PH 708 867 7.95e-8 SMART
C2 911 1016 2.85e-11 SMART
RhoGAP 1064 1248 6.42e-70 SMART
Meta Mutation Damage Score 0.8090 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are defective in hormonal and behavioral stress response regulation and prone to septic shock, whereas chimeric mice carrying a BCR-ABL fusion mutation mimicking human Philadelphia chromosome develop chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Hectd2 T A 19: 36,569,431 V64D probably damaging Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Bcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bcr APN 10 75157071 unclassified probably benign
IGL00662:Bcr APN 10 75168100 splice site probably benign
IGL01359:Bcr APN 10 75159779 unclassified probably benign
IGL01737:Bcr APN 10 75154951 missense probably damaging 0.99
IGL01908:Bcr APN 10 75061873 missense possibly damaging 0.85
IGL01954:Bcr APN 10 75175341 splice site probably null
IGL02169:Bcr APN 10 75159882 missense probably benign 0.07
IGL02379:Bcr APN 10 75157148 missense probably benign 0.02
IGL02380:Bcr APN 10 75175299 missense probably benign
IGL02385:Bcr APN 10 75145403 missense probably damaging 1.00
IGL02657:Bcr APN 10 75154964 missense probably benign 0.00
IGL02682:Bcr APN 10 75166046 missense possibly damaging 0.67
IGL02959:Bcr APN 10 75160390 missense probably benign 0.44
accrual UTSW 10 75061506 missense possibly damaging 0.77
Appreciation UTSW 10 75061125 nonsense probably null
R0329:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0330:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0376:Bcr UTSW 10 75145327 missense probably damaging 1.00
R0828:Bcr UTSW 10 75157207 unclassified probably benign
R0892:Bcr UTSW 10 75125063 missense probably benign 0.00
R1143:Bcr UTSW 10 75061365 missense probably benign 0.00
R1416:Bcr UTSW 10 75061506 missense possibly damaging 0.77
R1479:Bcr UTSW 10 75061125 nonsense probably null
R1611:Bcr UTSW 10 75125202 splice site probably null
R1636:Bcr UTSW 10 75131066 missense probably damaging 1.00
R1837:Bcr UTSW 10 75168100 splice site probably benign
R2341:Bcr UTSW 10 75131112 missense probably damaging 1.00
R2343:Bcr UTSW 10 75145422 missense probably benign 0.03
R3753:Bcr UTSW 10 75135940 missense probably benign 0.05
R4273:Bcr UTSW 10 75125111 missense probably damaging 0.97
R4624:Bcr UTSW 10 75153920 missense probably damaging 1.00
R4723:Bcr UTSW 10 75175329 missense probably benign 0.45
R5013:Bcr UTSW 10 75125066 missense probably benign 0.00
R5359:Bcr UTSW 10 75166085 missense probably damaging 0.99
R5458:Bcr UTSW 10 75154960 missense probably benign
R5982:Bcr UTSW 10 75176416 missense probably benign 0.08
R5988:Bcr UTSW 10 75175335 missense probably benign 0.01
R6220:Bcr UTSW 10 75062292 missense probably benign
R6827:Bcr UTSW 10 75131064 missense probably damaging 1.00
R6886:Bcr UTSW 10 75153937 missense probably damaging 1.00
R6990:Bcr UTSW 10 75131036 missense possibly damaging 0.80
R7003:Bcr UTSW 10 75061561 missense probably benign 0.08
R7424:Bcr UTSW 10 75157100 missense probably benign
R7443:Bcr UTSW 10 75143136 critical splice donor site probably null
R7488:Bcr UTSW 10 75160330 missense possibly damaging 0.80
R8232:Bcr UTSW 10 75166051 missense probably damaging 1.00
R8360:Bcr UTSW 10 75145439 missense probably damaging 0.96
R8992:Bcr UTSW 10 75131572 missense probably damaging 1.00
R9362:Bcr UTSW 10 75157191 missense probably benign 0.19
R9487:Bcr UTSW 10 75131599 missense probably damaging 1.00
R9610:Bcr UTSW 10 75154911 missense probably damaging 1.00
R9610:Bcr UTSW 10 75154913 nonsense probably null
R9611:Bcr UTSW 10 75154911 missense probably damaging 1.00
R9611:Bcr UTSW 10 75154913 nonsense probably null
R9630:Bcr UTSW 10 75131118 missense probably damaging 1.00
R9662:Bcr UTSW 10 75175320 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGAAGCCATTTCACCTGTGCC -3'
(R):5'- AACGCCAAGCAACACTGTAGGG -3'

Sequencing Primer
(F):5'- ACCTGTGCCATCCTCCAG -3'
(R):5'- TTTGGCACCAAAGGTACTCAG -3'
Posted On 2014-08-11