Mutagenetix > Incidental Mutation

Incidental Mutation 'R0685:Uhrf1'

218487

Institutional Source

Beutler Lab

Gene Symbol

Uhrf1

Ensembl Gene

ENSMUSG00000001228

Gene Name

ubiquitin-like, containing PHD and RING finger domains, 1

Synonyms

ICBP90, Np95

MMRRC Submission

038870-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0685 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

56303321-56323486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 56310742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 155 (V155L)

Ref Sequence

ENSEMBL: ENSMUSP00000108662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039] [ENSMUST00000142387]

AlphaFold

Q8VDF2

Predicted Effect

probably damaging
Transcript: ENSMUST00000001258
AA Change: V155L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228
AA Change: V155L

Domain	Start	End	E-Value	Type
UBQ	1	74	9.37e-10	SMART
Pfam:DUF3590	136	232	1.1e-42	PFAM
PHD	322	369	6.39e-12	SMART
RING	323	368	1.09e0	SMART
low complexity region	381	398	N/A	INTRINSIC
SRA	419	590	8.5e-113	SMART
low complexity region	635	653	N/A	INTRINSIC
RING	713	751	8.43e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113035
AA Change: V155L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228
AA Change: V155L

Domain	Start	End	E-Value	Type
UBQ	1	74	9.37e-10	SMART
Pfam:DUF3590	136	232	1.1e-42	PFAM
PHD	314	361	6.39e-12	SMART
RING	315	360	1.09e0	SMART
low complexity region	373	390	N/A	INTRINSIC
SRA	411	582	8.5e-113	SMART
low complexity region	627	645	N/A	INTRINSIC
RING	705	743	8.43e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113038
AA Change: V155L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228
AA Change: V155L

Domain	Start	End	E-Value	Type
UBQ	1	74	9.37e-10	SMART
Pfam:DUF3590	136	232	1.1e-42	PFAM
PHD	314	361	6.39e-12	SMART
RING	315	360	1.09e0	SMART
low complexity region	373	390	N/A	INTRINSIC
SRA	411	582	8.5e-113	SMART
low complexity region	627	645	N/A	INTRINSIC
RING	705	743	8.43e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113039
AA Change: V155L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228
AA Change: V155L

Domain	Start	End	E-Value	Type
UBQ	1	74	9.37e-10	SMART
Pfam:TTD	128	281	8e-61	PFAM
PHD	322	369	6.39e-12	SMART
RING	323	368	1.09e0	SMART
low complexity region	381	398	N/A	INTRINSIC
SRA	419	590	8.5e-113	SMART
low complexity region	635	653	N/A	INTRINSIC
RING	713	751	8.43e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137876

Predicted Effect

probably benign
Transcript: ENSMUST00000142387

SMART Domains

Protein: ENSMUSP00000125830
Gene: ENSMUSG00000001228

Domain	Start	End	E-Value	Type
UBQ	1	74	9.37e-10	SMART

Meta Mutation Damage Score

0.1966

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,593,438	D17G	probably damaging	Het
Abi3bp	A	G	16: 56,532,953	T82A	possibly damaging	Het
Adgre4	A	C	17: 55,792,035	E180D	probably benign	Het
Ankrd28	G	A	14: 31,743,450		probably benign	Het
Aoc3	A	G	11: 101,336,447	D382G	possibly damaging	Het
Apob	C	A	12: 8,010,742	R3075S	probably benign	Het
Aqr	A	G	2: 114,140,977	F459S	probably damaging	Het
Bcr	T	C	10: 75,131,643	W570R	probably damaging	Het
Bloc1s5	C	T	13: 38,603,919	R163K	probably benign	Het
Bod1	A	T	11: 31,669,267	N101K	possibly damaging	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Chl1	G	A	6: 103,708,542		probably null	Het
Clstn1	G	A	4: 149,646,855	A885T	probably benign	Het
Cyp3a25	G	T	5: 145,998,546	P87T	probably damaging	Het
Dync1h1	T	C	12: 110,657,192	V3633A	probably damaging	Het
Elp4	C	A	2: 105,792,277	C241F	possibly damaging	Het
Fat4	T	A	3: 39,001,178	F4182Y	probably benign	Het
Gabbr2	G	A	4: 46,787,521	H381Y	possibly damaging	Het
Gm10577	G	T	4: 101,020,318		probably benign	Het
Gm884	T	C	11: 103,616,888		probably benign	Het
Gm9955	G	T	18: 24,709,257		probably benign	Het
Gstm5	T	A	3: 107,897,319	I73N	probably damaging	Het
Gypa	T	A	8: 80,496,702		probably benign	Het
Hectd2	T	A	19: 36,569,431	V64D	probably damaging	Het
Igkv10-95	T	A	6: 68,680,559	Y20N	probably benign	Het
Il15	T	C	8: 82,337,559		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kiz	C	A	2: 146,856,058		probably benign	Het
Lcmt2	C	A	2: 121,139,240	S234I	probably benign	Het
Lilra5	A	G	7: 4,241,957		probably benign	Het
Lin37	T	C	7: 30,555,874	E187G	probably damaging	Het
Mcmdc2	T	A	1: 9,911,814		probably null	Het
Mctp1	T	C	13: 76,825,799		probably null	Het
Mdp1	C	A	14: 55,659,269	G112*	probably null	Het
Mmp15	T	C	8: 95,372,134	Y530H	possibly damaging	Het
Mtss1l	T	C	8: 110,727,397		probably null	Het
Muc5ac	T	C	7: 141,807,709	S1586P	probably benign	Het
Nap1l5	A	T	6: 58,906,772	C66S	possibly damaging	Het
Ninl	G	T	2: 150,939,855	Q1237K	possibly damaging	Het
Olfr1160	T	C	2: 88,006,418	E111G	probably damaging	Het
Olfr495	A	T	7: 108,395,263	T48S	possibly damaging	Het
Orc6	T	G	8: 85,301,154	S37R	possibly damaging	Het
Papss1	A	C	3: 131,583,093	N119H	possibly damaging	Het
Phf13	A	T	4: 151,991,612	F278I	probably damaging	Het
Pole2	C	A	12: 69,211,413	A239S	probably damaging	Het
Ppt2	T	C	17: 34,626,572	D75G	probably damaging	Het
Psd2	A	G	18: 36,002,991	D443G	possibly damaging	Het
Psen1	C	A	12: 83,714,820	S132*	probably null	Het
Psme4	A	G	11: 30,878,415	T1812A	probably damaging	Het
Rasgrf1	T	C	9: 89,915,482		probably benign	Het
Reep3	A	G	10: 67,021,739		probably benign	Het
Rexo4	A	T	2: 26,958,574		probably benign	Het
Rnf6	A	C	5: 146,211,658	S183R	probably damaging	Het
Scai	A	T	2: 39,103,737	M297K	probably damaging	Het
Scn9a	A	T	2: 66,483,499	S1947R	probably benign	Het
Sema6c	T	C	3: 95,172,710	C772R	possibly damaging	Het
Skint7	T	C	4: 111,980,345	S107P	possibly damaging	Het
Slc24a3	A	G	2: 145,606,795	N420D	probably benign	Het
Smc1b	T	C	15: 85,070,820	D1077G	possibly damaging	Het
Smg7	G	A	1: 152,866,648	P82L	probably damaging	Het
Sp3	A	C	2: 72,970,998	F268V	probably damaging	Het
Srms	T	C	2: 181,212,633	D47G	probably benign	Het
Ss18	A	C	18: 14,651,181	M150R	probably damaging	Het
Taf5	G	A	19: 47,074,854	R281Q	probably benign	Het
Tars	T	C	15: 11,385,173	K644R	probably benign	Het
Tctex1d1	T	C	4: 103,002,538	Y96H	probably damaging	Het
Tinag	C	A	9: 76,952,003	W441L	probably damaging	Het
Tmtc1	T	C	6: 148,411,240	S244G	probably benign	Het
Tpr	T	C	1: 150,433,725	V1670A	possibly damaging	Het
Trpv3	A	G	11: 73,296,814		probably benign	Het
Ush2a	G	A	1: 188,400,278	C899Y	probably damaging	Het
Vmn2r115	G	A	17: 23,359,275	R574H	probably benign	Het
Vmn2r63	T	C	7: 42,928,010	D368G	probably benign	Het
Vps13a	A	G	19: 16,780,741	V10A	probably damaging	Het
Wbp11	A	G	6: 136,814,638		probably benign	Het
Zcwpw1	A	G	5: 137,799,592	D145G	probably benign	Het
Zfp607a	G	A	7: 27,878,476	V324I	probably damaging	Het
Zfp618	A	G	4: 63,133,774	I931V	probably benign	Het
Zfp821	T	C	8: 109,724,542	V389A	possibly damaging	Het
Zfp976	T	A	7: 42,613,717	H232L	probably damaging	Het

Other mutations in Uhrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00560:Uhrf1	APN	17	56318125	missense	probably damaging	1.00
IGL00925:Uhrf1	APN	17	56320535	missense	probably benign	0.00
IGL01432:Uhrf1	APN	17	56318250	missense	probably damaging	1.00
IGL02739:Uhrf1	APN	17	56305129	missense	probably benign	0.03
R0667:Uhrf1	UTSW	17	56310677	missense	probably benign	0.01
R1121:Uhrf1	UTSW	17	56312917	missense	probably benign
R1462:Uhrf1	UTSW	17	56318035	missense	probably damaging	1.00
R1462:Uhrf1	UTSW	17	56318035	missense	probably damaging	1.00
R2088:Uhrf1	UTSW	17	56318089	missense	probably damaging	1.00
R2329:Uhrf1	UTSW	17	56310671	splice site	probably null
R2331:Uhrf1	UTSW	17	56310671	splice site	probably null
R2332:Uhrf1	UTSW	17	56310671	splice site	probably null
R3624:Uhrf1	UTSW	17	56317023	missense	probably damaging	1.00
R4065:Uhrf1	UTSW	17	56318020	missense	probably damaging	1.00
R4882:Uhrf1	UTSW	17	56309401	missense	probably damaging	1.00
R4901:Uhrf1	UTSW	17	56310834	missense	probably benign	0.01
R4913:Uhrf1	UTSW	17	56315478	missense	probably damaging	0.99
R5061:Uhrf1	UTSW	17	56320542	splice site	probably null
R5186:Uhrf1	UTSW	17	56318340	missense	probably damaging	1.00
R5711:Uhrf1	UTSW	17	56320259	missense	possibly damaging	0.49
R6917:Uhrf1	UTSW	17	56309574	missense	probably damaging	1.00
R7021:Uhrf1	UTSW	17	56320450	missense	probably benign	0.04
R7241:Uhrf1	UTSW	17	56315193	missense	probably damaging	1.00
R7692:Uhrf1	UTSW	17	56312905	missense	possibly damaging	0.91
R7875:Uhrf1	UTSW	17	56312884	missense	possibly damaging	0.46
R8540:Uhrf1	UTSW	17	56305105	missense	probably damaging	1.00
R8731:Uhrf1	UTSW	17	56322363	missense	probably damaging	1.00
R8897:Uhrf1	UTSW	17	56310817	missense	probably damaging	1.00
R9349:Uhrf1	UTSW	17	56310737	missense	possibly damaging	0.95
R9681:Uhrf1	UTSW	17	56318083	missense	possibly damaging	0.51
R9708:Uhrf1	UTSW	17	56322357	missense	probably benign	0.01
R9723:Uhrf1	UTSW	17	56318061	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTCACAGCCATCAGAGCAGAGG -3'
(R):5'- CATATCCCCAGCAGCAGTCACTTG -3'

Sequencing Primer
(F):5'- ctcacacctaacatccccttac -3'
(R):5'- CAGCAGTCACTTGGGGAG -3'

Posted On

2014-08-11