Incidental Mutation 'R0685:Hectd2'
ID 218488
Institutional Source Beutler Lab
Gene Symbol Hectd2
Ensembl Gene ENSMUSG00000041180
Gene Name HECT domain E3 ubiquitin protein ligase 2
Synonyms A630025O09Rik
MMRRC Submission 038870-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0685 (G1)
Quality Score 52
Status Validated
Chromosome 19
Chromosomal Location 36554639-36621135 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36569431 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 64 (V64D)
Ref Sequence ENSEMBL: ENSMUSP00000117273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047247] [ENSMUST00000139215] [ENSMUST00000169036]
AlphaFold Q8CDU6
Predicted Effect probably benign
Transcript: ENSMUST00000047247
AA Change: V64D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042646
Gene: ENSMUSG00000041180
AA Change: V64D

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 433 774 1.33e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139215
AA Change: V64D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117273
Gene: ENSMUSG00000041180
AA Change: V64D

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155447
Predicted Effect unknown
Transcript: ENSMUST00000155594
AA Change: V36D
SMART Domains Protein: ENSMUSP00000120791
Gene: ENSMUSG00000041180
AA Change: V36D

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
low complexity region 82 101 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169036
AA Change: V64D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128387
Gene: ENSMUSG00000041180
AA Change: V64D

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 434 775 1.33e-115 SMART
Meta Mutation Damage Score 0.0901 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,593,438 D17G probably damaging Het
Abi3bp A G 16: 56,532,953 T82A possibly damaging Het
Adgre4 A C 17: 55,792,035 E180D probably benign Het
Ankrd28 G A 14: 31,743,450 probably benign Het
Aoc3 A G 11: 101,336,447 D382G possibly damaging Het
Apob C A 12: 8,010,742 R3075S probably benign Het
Aqr A G 2: 114,140,977 F459S probably damaging Het
Bcr T C 10: 75,131,643 W570R probably damaging Het
Bloc1s5 C T 13: 38,603,919 R163K probably benign Het
Bod1 A T 11: 31,669,267 N101K possibly damaging Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Chl1 G A 6: 103,708,542 probably null Het
Clstn1 G A 4: 149,646,855 A885T probably benign Het
Cyp3a25 G T 5: 145,998,546 P87T probably damaging Het
Dync1h1 T C 12: 110,657,192 V3633A probably damaging Het
Elp4 C A 2: 105,792,277 C241F possibly damaging Het
Fat4 T A 3: 39,001,178 F4182Y probably benign Het
Gabbr2 G A 4: 46,787,521 H381Y possibly damaging Het
Gm10577 G T 4: 101,020,318 probably benign Het
Gm884 T C 11: 103,616,888 probably benign Het
Gm9955 G T 18: 24,709,257 probably benign Het
Gstm5 T A 3: 107,897,319 I73N probably damaging Het
Gypa T A 8: 80,496,702 probably benign Het
Igkv10-95 T A 6: 68,680,559 Y20N probably benign Het
Il15 T C 8: 82,337,559 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kiz C A 2: 146,856,058 probably benign Het
Lcmt2 C A 2: 121,139,240 S234I probably benign Het
Lilra5 A G 7: 4,241,957 probably benign Het
Lin37 T C 7: 30,555,874 E187G probably damaging Het
Mcmdc2 T A 1: 9,911,814 probably null Het
Mctp1 T C 13: 76,825,799 probably null Het
Mdp1 C A 14: 55,659,269 G112* probably null Het
Mmp15 T C 8: 95,372,134 Y530H possibly damaging Het
Mtss1l T C 8: 110,727,397 probably null Het
Muc5ac T C 7: 141,807,709 S1586P probably benign Het
Nap1l5 A T 6: 58,906,772 C66S possibly damaging Het
Ninl G T 2: 150,939,855 Q1237K possibly damaging Het
Olfr1160 T C 2: 88,006,418 E111G probably damaging Het
Olfr495 A T 7: 108,395,263 T48S possibly damaging Het
Orc6 T G 8: 85,301,154 S37R possibly damaging Het
Papss1 A C 3: 131,583,093 N119H possibly damaging Het
Phf13 A T 4: 151,991,612 F278I probably damaging Het
Pole2 C A 12: 69,211,413 A239S probably damaging Het
Ppt2 T C 17: 34,626,572 D75G probably damaging Het
Psd2 A G 18: 36,002,991 D443G possibly damaging Het
Psen1 C A 12: 83,714,820 S132* probably null Het
Psme4 A G 11: 30,878,415 T1812A probably damaging Het
Rasgrf1 T C 9: 89,915,482 probably benign Het
Reep3 A G 10: 67,021,739 probably benign Het
Rexo4 A T 2: 26,958,574 probably benign Het
Rnf6 A C 5: 146,211,658 S183R probably damaging Het
Scai A T 2: 39,103,737 M297K probably damaging Het
Scn9a A T 2: 66,483,499 S1947R probably benign Het
Sema6c T C 3: 95,172,710 C772R possibly damaging Het
Skint7 T C 4: 111,980,345 S107P possibly damaging Het
Slc24a3 A G 2: 145,606,795 N420D probably benign Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Smg7 G A 1: 152,866,648 P82L probably damaging Het
Sp3 A C 2: 72,970,998 F268V probably damaging Het
Srms T C 2: 181,212,633 D47G probably benign Het
Ss18 A C 18: 14,651,181 M150R probably damaging Het
Taf5 G A 19: 47,074,854 R281Q probably benign Het
Tars T C 15: 11,385,173 K644R probably benign Het
Tctex1d1 T C 4: 103,002,538 Y96H probably damaging Het
Tinag C A 9: 76,952,003 W441L probably damaging Het
Tmtc1 T C 6: 148,411,240 S244G probably benign Het
Tpr T C 1: 150,433,725 V1670A possibly damaging Het
Trpv3 A G 11: 73,296,814 probably benign Het
Uhrf1 G T 17: 56,310,742 V155L probably damaging Het
Ush2a G A 1: 188,400,278 C899Y probably damaging Het
Vmn2r115 G A 17: 23,359,275 R574H probably benign Het
Vmn2r63 T C 7: 42,928,010 D368G probably benign Het
Vps13a A G 19: 16,780,741 V10A probably damaging Het
Wbp11 A G 6: 136,814,638 probably benign Het
Zcwpw1 A G 5: 137,799,592 D145G probably benign Het
Zfp607a G A 7: 27,878,476 V324I probably damaging Het
Zfp618 A G 4: 63,133,774 I931V probably benign Het
Zfp821 T C 8: 109,724,542 V389A possibly damaging Het
Zfp976 T A 7: 42,613,717 H232L probably damaging Het
Other mutations in Hectd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Hectd2 APN 19 36584936 missense probably benign
IGL01024:Hectd2 APN 19 36606393 missense probably damaging 1.00
IGL01111:Hectd2 APN 19 36597120 missense probably damaging 1.00
IGL01301:Hectd2 APN 19 36569370 splice site probably benign
IGL02019:Hectd2 APN 19 36615516 missense possibly damaging 0.94
IGL02410:Hectd2 APN 19 36595213 nonsense probably null
IGL02793:Hectd2 APN 19 36587421 missense probably damaging 0.99
IGL03010:Hectd2 APN 19 36615602 missense probably benign 0.01
IGL03115:Hectd2 APN 19 36599721 critical splice donor site probably null
IGL03251:Hectd2 APN 19 36585526 missense probably damaging 1.00
chopstix1 UTSW 19 36609416 missense possibly damaging 0.75
Chopstix3 UTSW 19 36615508 nonsense probably null
R0402:Hectd2 UTSW 19 36601529 critical splice donor site probably null
R0415:Hectd2 UTSW 19 36584884 unclassified probably benign
R0576:Hectd2 UTSW 19 36585497 missense probably benign
R1460:Hectd2 UTSW 19 36615508 nonsense probably null
R1791:Hectd2 UTSW 19 36609416 missense possibly damaging 0.75
R1895:Hectd2 UTSW 19 36614460 missense probably damaging 1.00
R1928:Hectd2 UTSW 19 36612319 missense probably damaging 1.00
R2116:Hectd2 UTSW 19 36614424 missense probably damaging 0.99
R2520:Hectd2 UTSW 19 36612233 critical splice donor site probably null
R4693:Hectd2 UTSW 19 36614338 splice site probably benign
R4858:Hectd2 UTSW 19 36605282 missense probably damaging 0.98
R4943:Hectd2 UTSW 19 36604247 splice site probably null
R5031:Hectd2 UTSW 19 36599604 missense probably damaging 1.00
R5408:Hectd2 UTSW 19 36554896 missense possibly damaging 0.46
R5621:Hectd2 UTSW 19 36618751 missense probably damaging 1.00
R5652:Hectd2 UTSW 19 36604320 missense probably damaging 1.00
R5704:Hectd2 UTSW 19 36598891 missense possibly damaging 0.93
R5950:Hectd2 UTSW 19 36597239 intron probably benign
R6414:Hectd2 UTSW 19 36618786 missense probably benign 0.21
R6438:Hectd2 UTSW 19 36618842 makesense probably null
R6544:Hectd2 UTSW 19 36612328 missense probably damaging 1.00
R6545:Hectd2 UTSW 19 36587378 missense probably benign 0.35
R6629:Hectd2 UTSW 19 36615538 missense probably damaging 1.00
R6672:Hectd2 UTSW 19 36587380 missense probably damaging 1.00
R6741:Hectd2 UTSW 19 36612359 missense probably damaging 1.00
R7117:Hectd2 UTSW 19 36599655 missense probably benign 0.29
R7238:Hectd2 UTSW 19 36597078 missense probably damaging 0.98
R7555:Hectd2 UTSW 19 36612403 missense probably damaging 1.00
R8184:Hectd2 UTSW 19 36604354 missense possibly damaging 0.83
R9069:Hectd2 UTSW 19 36585462 missense probably benign 0.00
R9149:Hectd2 UTSW 19 36599002 missense probably damaging 0.99
R9418:Hectd2 UTSW 19 36612174 missense probably benign 0.01
R9514:Hectd2 UTSW 19 36605289 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCGGCTCTCTATGCTTATGCTGAT -3'
(R):5'- TTTGACTACTGTGAGGGTGCAATGAAA -3'

Sequencing Primer
(F):5'- CTCTATGCTTATGCTGATTTGGTC -3'
(R):5'- TGAGGGCATTCCAAACTTCAAAG -3'
Posted On 2014-08-11