Incidental Mutation 'R0600:Hook3'
ID 218515
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
MMRRC Submission 038789-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0600 (G1)
Quality Score 47
Status Validated
Chromosome 8
Chromosomal Location 26511449-26609252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26609014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014022] [ENSMUST00000037182] [ENSMUST00000110575] [ENSMUST00000110579] [ENSMUST00000124757] [ENSMUST00000209300] [ENSMUST00000209707] [ENSMUST00000140819] [ENSMUST00000131138] [ENSMUST00000153528]
AlphaFold Q8BUK6
Predicted Effect probably benign
Transcript: ENSMUST00000014022
SMART Domains Protein: ENSMUSP00000014022
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 157 1.06e-8 SMART
Pfam:DUF1232 230 267 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037182
AA Change: V10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: V10A

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110573
SMART Domains Protein: ENSMUSP00000106202
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110575
SMART Domains Protein: ENSMUSP00000106204
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 163 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110579
SMART Domains Protein: ENSMUSP00000106208
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 138 6.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124757
SMART Domains Protein: ENSMUSP00000115588
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 136 6e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209300
Predicted Effect probably benign
Transcript: ENSMUST00000209707
Predicted Effect probably benign
Transcript: ENSMUST00000124867
SMART Domains Protein: ENSMUSP00000115959
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
SCOP:d1fbva4 49 99 9e-7 SMART
Blast:RING 79 100 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140819
SMART Domains Protein: ENSMUSP00000119906
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131138
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153528
SMART Domains Protein: ENSMUSP00000118689
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
RING 68 110 1.06e-8 SMART
Pfam:DUF1232 181 221 3.7e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,959,389 (GRCm39) S150P probably damaging Het
5530400C23Rik T G 6: 133,270,174 (GRCm39) probably benign Het
Ahctf1 A C 1: 179,591,033 (GRCm39) probably null Het
Ang5 T C 14: 44,200,206 (GRCm39) V90A probably benign Het
Ano9 C T 7: 140,684,623 (GRCm39) G442R probably damaging Het
Apaf1 G A 10: 90,895,914 (GRCm39) T386I probably damaging Het
Apob C A 12: 8,056,440 (GRCm39) H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 (GRCm39) probably benign Het
Asxl1 T A 2: 153,241,824 (GRCm39) D791E probably benign Het
Avl9 T C 6: 56,713,891 (GRCm39) V383A probably benign Het
Btbd1 A C 7: 81,465,754 (GRCm39) D197E probably damaging Het
Camta2 T C 11: 70,564,785 (GRCm39) I938V possibly damaging Het
Ccn5 G A 2: 163,667,233 (GRCm39) C78Y probably damaging Het
Cdca7 C A 2: 72,313,811 (GRCm39) A200D possibly damaging Het
Cep104 A T 4: 154,091,249 (GRCm39) Y923F possibly damaging Het
Cep135 G C 5: 76,769,152 (GRCm39) V601L probably benign Het
Ces2b G A 8: 105,562,542 (GRCm39) G291S probably benign Het
Col6a6 C T 9: 105,638,639 (GRCm39) G1400D probably damaging Het
Cyth2 T C 7: 45,462,541 (GRCm39) E1G probably damaging Het
Dand5 A T 8: 85,542,921 (GRCm39) L185Q probably damaging Het
Dck T C 5: 88,929,080 (GRCm39) V253A probably benign Het
Ddx20 A G 3: 105,586,396 (GRCm39) S650P probably damaging Het
Dicer1 G A 12: 104,673,123 (GRCm39) P799S probably damaging Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Eya2 G A 2: 165,611,157 (GRCm39) C477Y probably damaging Het
Fip1l1 T A 5: 74,756,503 (GRCm39) N498K probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Galntl6 T C 8: 58,290,217 (GRCm39) probably null Het
Gda A T 19: 21,411,667 (GRCm39) F44I possibly damaging Het
Gli2 G A 1: 118,768,119 (GRCm39) R703C probably damaging Het
Golgb1 T A 16: 36,736,633 (GRCm39) L1960Q probably damaging Het
Gramd1b T C 9: 40,219,651 (GRCm39) D341G probably damaging Het
Grid2 G T 6: 63,480,419 (GRCm39) A78S probably benign Het
Hao2 A T 3: 98,790,876 (GRCm39) probably benign Het
Kif20a A G 18: 34,762,262 (GRCm39) E425G probably damaging Het
Lrp1 T C 10: 127,403,252 (GRCm39) D2107G probably benign Het
Lrriq3 T C 3: 154,893,373 (GRCm39) I358T possibly damaging Het
Mad2l2 A G 4: 148,225,381 (GRCm39) D17G possibly damaging Het
Mastl G T 2: 23,023,358 (GRCm39) T455K probably benign Het
Mkln1 G T 6: 31,409,862 (GRCm39) probably benign Het
Mmp1b A T 9: 7,387,947 (GRCm39) Y16N possibly damaging Het
Mmp24 C T 2: 155,634,517 (GRCm39) A79V probably benign Het
Mrps35 T A 6: 146,972,232 (GRCm39) C292S possibly damaging Het
Myom1 T C 17: 71,427,643 (GRCm39) F1435L possibly damaging Het
Nars2 C T 7: 96,689,130 (GRCm39) H351Y probably damaging Het
Nat2 A T 8: 67,953,919 (GRCm39) I10F probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm5 A T 7: 103,803,076 (GRCm39) Y462* probably null Het
Or13p5 C T 4: 118,591,986 (GRCm39) H87Y probably damaging Het
Or1j12 C A 2: 36,342,660 (GRCm39) A21E probably benign Het
Or2w3 C A 11: 58,556,986 (GRCm39) F200L probably damaging Het
Or4c122 C A 2: 89,079,742 (GRCm39) E87* probably null Het
Or4e1 T C 14: 52,700,966 (GRCm39) I167V probably benign Het
Or5p70 T A 7: 107,994,438 (GRCm39) I37N probably damaging Het
Or7g35 T C 9: 19,496,600 (GRCm39) S256P possibly damaging Het
Or8d2b T A 9: 38,789,111 (GRCm39) I213N probably damaging Het
Or8g20 A T 9: 39,396,284 (GRCm39) F85L probably benign Het
Otog A T 7: 45,900,819 (GRCm39) probably benign Het
Pdcd2l A T 7: 33,892,232 (GRCm39) D212E possibly damaging Het
Pex5 T C 6: 124,381,596 (GRCm39) N213S probably benign Het
Pkn3 C T 2: 29,971,146 (GRCm39) P238S probably benign Het
Pramel32 A T 4: 88,547,536 (GRCm39) I45K probably damaging Het
Prl2b1 A T 13: 27,574,723 (GRCm39) probably null Het
Ptprb A T 10: 116,204,712 (GRCm39) I1849L possibly damaging Het
Rasal3 G T 17: 32,612,500 (GRCm39) S787Y probably damaging Het
Scn2a T A 2: 65,532,177 (GRCm39) D596E possibly damaging Het
Sdhd A T 9: 50,515,064 (GRCm39) V9D possibly damaging Het
Serinc5 T C 13: 92,844,565 (GRCm39) S436P probably damaging Het
Slc27a1 C T 8: 72,036,808 (GRCm39) P348L probably damaging Het
Slc28a2b A T 2: 122,344,879 (GRCm39) I162F probably damaging Het
Smg1 G A 7: 117,759,606 (GRCm39) probably benign Het
Sorl1 A T 9: 41,955,196 (GRCm39) probably benign Het
Sprtn T A 8: 125,626,957 (GRCm39) H112Q probably damaging Het
Tasor2 A T 13: 3,626,054 (GRCm39) F1299I probably benign Het
Tet2 A G 3: 133,173,363 (GRCm39) M1633T probably benign Het
Tet2 T A 3: 133,173,486 (GRCm39) D1592V probably benign Het
Tmem68 A T 4: 3,569,667 (GRCm39) C8S probably damaging Het
Tnrc6a T A 7: 122,771,039 (GRCm39) I943N probably benign Het
Trib2 A T 12: 15,844,069 (GRCm39) V191D probably damaging Het
Tsc22d4 T C 5: 137,760,917 (GRCm39) S113P probably damaging Het
Ttc21b T C 2: 66,069,914 (GRCm39) R250G probably damaging Het
Ubr2 T C 17: 47,278,174 (GRCm39) Y721C probably damaging Het
Ubtfl1 A T 9: 18,320,660 (GRCm39) I63F probably damaging Het
Ush1c G A 7: 45,874,332 (GRCm39) P171S probably benign Het
Utp20 A T 10: 88,603,323 (GRCm39) N1843K probably damaging Het
Vangl1 A G 3: 102,074,253 (GRCm39) Y285H probably damaging Het
Virma A G 4: 11,498,769 (GRCm39) D70G probably damaging Het
Vmn2r102 T C 17: 19,898,277 (GRCm39) F431L probably benign Het
Wdr17 A G 8: 55,114,530 (GRCm39) I662T probably damaging Het
Wdr87-ps T A 7: 29,232,690 (GRCm39) noncoding transcript Het
Zfp160 G A 17: 21,247,268 (GRCm39) R606H probably benign Het
Zfp369 C T 13: 65,444,248 (GRCm39) R464C probably damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26,549,278 (GRCm39) missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26,538,326 (GRCm39) missense probably damaging 1.00
IGL01145:Hook3 APN 8 26,549,372 (GRCm39) missense probably benign 0.00
IGL01514:Hook3 APN 8 26,578,217 (GRCm39) missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26,560,187 (GRCm39) missense probably benign 0.00
IGL01832:Hook3 APN 8 26,562,393 (GRCm39) missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26,529,760 (GRCm39) missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26,578,083 (GRCm39) splice site probably benign
IGL01948:Hook3 APN 8 26,549,340 (GRCm39) missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26,560,293 (GRCm39) missense probably damaging 0.99
IGL02675:Hook3 APN 8 26,551,462 (GRCm39) missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26,585,782 (GRCm39) splice site probably benign
Rufio UTSW 8 26,524,968 (GRCm39) nonsense probably null
R0384:Hook3 UTSW 8 26,534,263 (GRCm39) splice site probably null
R1037:Hook3 UTSW 8 26,562,378 (GRCm39) missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26,528,134 (GRCm39) missense probably damaging 0.98
R1563:Hook3 UTSW 8 26,600,780 (GRCm39) missense probably benign 0.06
R1767:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R1806:Hook3 UTSW 8 26,558,687 (GRCm39) missense probably damaging 1.00
R2025:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2026:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2027:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2091:Hook3 UTSW 8 26,549,422 (GRCm39) splice site probably benign
R2153:Hook3 UTSW 8 26,560,225 (GRCm39) missense probably damaging 1.00
R2184:Hook3 UTSW 8 26,609,011 (GRCm39) missense probably benign 0.00
R4586:Hook3 UTSW 8 26,522,039 (GRCm39) missense probably damaging 0.98
R4863:Hook3 UTSW 8 26,528,057 (GRCm39) missense probably damaging 1.00
R4971:Hook3 UTSW 8 26,572,607 (GRCm39) missense probably benign 0.22
R5023:Hook3 UTSW 8 26,522,047 (GRCm39) frame shift probably null
R5026:Hook3 UTSW 8 26,600,785 (GRCm39) missense probably damaging 0.98
R5068:Hook3 UTSW 8 26,585,785 (GRCm39) critical splice donor site probably null
R5253:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
R5383:Hook3 UTSW 8 26,609,017 (GRCm39) missense probably benign 0.01
R5437:Hook3 UTSW 8 26,551,450 (GRCm39) missense probably benign 0.05
R5528:Hook3 UTSW 8 26,562,321 (GRCm39) missense probably damaging 1.00
R5551:Hook3 UTSW 8 26,558,639 (GRCm39) missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26,534,355 (GRCm39) intron probably benign
R5907:Hook3 UTSW 8 26,534,306 (GRCm39) intron probably benign
R6082:Hook3 UTSW 8 26,600,813 (GRCm39) missense probably benign 0.00
R6124:Hook3 UTSW 8 26,549,300 (GRCm39) missense probably benign 0.20
R6301:Hook3 UTSW 8 26,524,968 (GRCm39) nonsense probably null
R6314:Hook3 UTSW 8 26,578,136 (GRCm39) missense probably benign
R6448:Hook3 UTSW 8 26,583,692 (GRCm39) missense probably benign 0.02
R6810:Hook3 UTSW 8 26,522,450 (GRCm39) splice site probably null
R7168:Hook3 UTSW 8 26,561,114 (GRCm39) missense probably benign 0.02
R7856:Hook3 UTSW 8 26,525,249 (GRCm39) missense probably damaging 1.00
R7988:Hook3 UTSW 8 26,563,675 (GRCm39) missense probably benign 0.02
R8079:Hook3 UTSW 8 26,578,086 (GRCm39) critical splice donor site probably null
R9121:Hook3 UTSW 8 26,525,195 (GRCm39) missense probably damaging 1.00
R9223:Hook3 UTSW 8 26,522,552 (GRCm39) missense
R9244:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R9246:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGTTCCTCCTGGACCCTGG -3'
(R):5'- CGTGCAAACTACAGGCGGCTTC -3'

Sequencing Primer
(F):5'- TCCCTGCTGACCCTGAC -3'
(R):5'- GAGACACACAGAccggc -3'
Posted On 2014-08-14