Mutagenetix > Incidental Mutations

Incidental Mutation 'R0690:Gria4'

218532

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

038875-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.614) question?

Stock #

R0690 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4427071 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 790 (Y790H)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

Predicted Effect

probably benign
Transcript: ENSMUST00000027020

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000063508
AA Change: Y790H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: Y790H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212533

Meta Mutation Damage Score

0.2802

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (87/90)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,969,808		probably benign	Het
Abi3	T	C	11: 95,833,634		probably benign	Het
Adam2	T	C	14: 66,057,646	N250S	probably damaging	Het
Agbl4	T	A	4: 111,657,388	I532K	probably benign	Het
Agrn	T	G	4: 156,174,453	E905A	probably damaging	Het
Ahi1	A	G	10: 20,970,843		probably benign	Het
Aifm2	A	G	10: 61,726,452	N89S	probably benign	Het
Arsj	C	T	3: 126,438,184	T193I	probably damaging	Het
Ascc2	T	A	11: 4,682,933	V702E	probably damaging	Het
Avpr1b	T	C	1: 131,600,281	S181P	probably damaging	Het
Bcl7a	G	A	5: 123,351,940	V56I	possibly damaging	Het
Cd160	T	A	3: 96,805,786	D54V	probably damaging	Het
Celsr2	C	A	3: 108,414,977	R173M	probably damaging	Het
Cfap57	A	G	4: 118,569,727		probably benign	Het
Cfap69	G	A	5: 5,663,951	T27I	probably damaging	Het
Chaf1b	T	C	16: 93,900,017		probably benign	Het
Cldn8	C	T	16: 88,562,639	V133M	probably damaging	Het
Col2a1	A	T	15: 97,980,192	V954E	unknown	Het
Col6a4	T	C	9: 106,028,187		probably benign	Het
Col6a6	T	C	9: 105,709,486	M1779V	probably benign	Het
Coq8b	A	G	7: 27,242,249	E253G	probably benign	Het
Ctse	T	C	1: 131,674,778		probably benign	Het
Cyp2c29	T	A	19: 39,309,726	N238K	probably benign	Het
Dcaf1	T	A	9: 106,846,649		probably benign	Het
Dcc	A	T	18: 71,809,204		probably benign	Het
Dkk1	A	G	19: 30,549,345	F12S	probably benign	Het
Dnah6	A	G	6: 73,129,474	V1760A	probably benign	Het
Fam117b	G	A	1: 59,958,353	S288N	possibly damaging	Het
Fam216a	A	T	5: 122,367,646	M110K	probably damaging	Het
Frem3	T	A	8: 80,613,952	I958N	possibly damaging	Het
Gab1	T	A	8: 80,800,116	N118Y	probably damaging	Het
Gda	T	A	19: 21,409,887	I251L	probably benign	Het
Gli2	C	A	1: 118,844,460	R505L	probably damaging	Het
Gm5093	A	T	17: 46,439,738	I121N	possibly damaging	Het
Gpnmb	C	T	6: 49,048,015	S327L	probably benign	Het
Gpr156	T	A	16: 37,992,141	Y280N	probably damaging	Het
Guf1	C	A	5: 69,566,352		probably null	Het
H6pd	T	C	4: 149,982,573	E452G	possibly damaging	Het
Herc1	T	A	9: 66,386,838	Y487*	probably null	Het
Ifi30	T	A	8: 70,764,949		probably benign	Het
Klf13	G	A	7: 63,938,071	A159V	possibly damaging	Het
Med11	T	A	11: 70,453,226	M124K	possibly damaging	Het
Myom3	A	G	4: 135,788,426		probably benign	Het
Nat2	A	T	8: 67,501,804	I189F	probably damaging	Het
Nhlrc4	C	G	17: 25,943,684	G30R	probably damaging	Het
Nkx3-2	G	A	5: 41,762,127	R173C	probably damaging	Het
Nox3	T	C	17: 3,695,564	N23S	probably damaging	Het
Npr2	A	T	4: 43,646,991	Y708F	probably damaging	Het
Nsun2	A	G	13: 69,629,542	N409S	probably benign	Het
Nucb2	T	C	7: 116,535,851		probably benign	Het
Olfr1105	A	G	2: 87,033,882	F113S	probably damaging	Het
Olfr541	T	C	7: 140,704,787	F179L	possibly damaging	Het
Olfr874	T	C	9: 37,746,217	F28L	probably benign	Het
Orai2	A	T	5: 136,161,599	V52D	probably damaging	Het
Pcyox1	A	T	6: 86,394,442	M154K	probably damaging	Het
Pik3r4	C	A	9: 105,653,976	T492K	possibly damaging	Het
Pmpca	T	A	2: 26,391,097	Y150N	probably damaging	Het
Ppp1r12b	G	T	1: 134,876,082	S446R	probably damaging	Het
Ptpdc1	A	G	13: 48,586,905	I289T	probably benign	Het
Pyroxd2	A	G	19: 42,727,642		probably benign	Het
Qrfpr	G	A	3: 36,189,559	T131M	probably damaging	Het
Rab33b	A	G	3: 51,493,417	Y104C	probably damaging	Het
Rad54l	G	T	4: 116,099,750		probably benign	Het
Rad9a	A	T	19: 4,197,360		probably null	Het
Slc1a5	A	T	7: 16,786,904	M233L	probably benign	Het
Slc47a2	C	T	11: 61,342,504	V67I	possibly damaging	Het
Slco1a5	T	A	6: 142,268,278	Y39F	probably benign	Het
Slfn5	T	C	11: 82,961,403	V785A	probably damaging	Het
Sp6	C	T	11: 97,021,544	P28S	possibly damaging	Het
Sptbn5	A	G	2: 120,062,675		probably null	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
St8sia1	A	G	6: 142,829,254	W200R	probably damaging	Het
Stxbp1	C	A	2: 32,800,695		probably benign	Het
Syne1	A	G	10: 5,033,138		probably benign	Het
Thbs3	T	A	3: 89,220,165	I371N	possibly damaging	Het
Tll1	C	T	8: 64,074,290	S399N	probably damaging	Het
Tmem209	A	C	6: 30,505,834	C114G	probably null	Het
Tmem25	C	T	9: 44,795,514		probably benign	Het
Tmem8b	T	C	4: 43,674,562	I282T	possibly damaging	Het
Trdmt1	T	A	2: 13,544,580	H18L	probably benign	Het
Trim63	A	G	4: 134,316,405	T60A	probably benign	Het
Trpv2	T	C	11: 62,584,676		probably null	Het
Ubr2	A	T	17: 46,938,653	I1591K	probably damaging	Het
Use1	A	T	8: 71,367,065		probably benign	Het
Zfp850	A	T	7: 27,985,217	C35S	possibly damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGTGTAGTAAGACGACCTTGAGTGTCA -3'
(R):5'- CCGTCACTTTGCCATGCGATTCTAA -3'

Sequencing Primer
(F):5'- GGTCTCTTTATCCAAAACAAACCTG -3'
(R):5'- CTTTGCCATGCGATTCTAATGTAG -3'

Posted On

2014-08-18