Incidental Mutation 'R0690:Slc47a2'
ID218536
Institutional Source Beutler Lab
Gene Symbol Slc47a2
Ensembl Gene ENSMUSG00000069855
Gene Namesolute carrier family 47, member 2
Synonyms4933429E10Rik
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0690 (G1)
Quality Score56
Status Validated
Chromosome11
Chromosomal Location61301631-61342860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61342504 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 67 (V67I)
Ref Sequence ENSEMBL: ENSMUSP00000090710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010267] [ENSMUST00000093029] [ENSMUST00000131723] [ENSMUST00000134423]
Predicted Effect probably benign
Transcript: ENSMUST00000010267
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093029
AA Change: V67I

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090710
Gene: ENSMUSG00000069855
AA Change: V67I

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 1.7e-35 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 4e-34 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131723
SMART Domains Protein: ENSMUSP00000115132
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 180 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134423
AA Change: V67I

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120907
Gene: ENSMUSG00000069855
AA Change: V67I

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 3.5e-32 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 1.7e-36 PFAM
transmembrane domain 444 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147450
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Slc47a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc47a2 APN 11 61302233 missense probably benign 0.16
IGL01367:Slc47a2 APN 11 61329781 missense probably benign 0.03
IGL01681:Slc47a2 APN 11 61338040 missense probably damaging 1.00
IGL01874:Slc47a2 APN 11 61312859 critical splice acceptor site probably null
IGL02049:Slc47a2 APN 11 61342539 missense probably damaging 0.98
IGL02399:Slc47a2 APN 11 61302194 unclassified probably benign
IGL02481:Slc47a2 APN 11 61336241 missense possibly damaging 0.58
IGL02880:Slc47a2 APN 11 61307540 missense probably damaging 0.97
IGL03068:Slc47a2 APN 11 61303943 missense probably damaging 1.00
IGL03136:Slc47a2 APN 11 61310765 missense probably benign 0.00
IGL03236:Slc47a2 APN 11 61313679 missense probably damaging 1.00
IGL03286:Slc47a2 APN 11 61342467 missense possibly damaging 0.57
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0597:Slc47a2 UTSW 11 61309976 missense probably damaging 0.98
R2042:Slc47a2 UTSW 11 61338082 missense probably benign 0.05
R2217:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2218:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2271:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R2272:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R4067:Slc47a2 UTSW 11 61303947 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4862:Slc47a2 UTSW 11 61313694 missense possibly damaging 0.69
R4985:Slc47a2 UTSW 11 61302233 missense probably benign
R5419:Slc47a2 UTSW 11 61307586 missense probably benign
R5593:Slc47a2 UTSW 11 61342660 missense probably benign 0.00
R7105:Slc47a2 UTSW 11 61342443 missense probably benign 0.07
R7358:Slc47a2 UTSW 11 61308873 missense possibly damaging 0.78
R7522:Slc47a2 UTSW 11 61302250 missense probably benign 0.14
Z1176:Slc47a2 UTSW 11 61325889 missense probably benign 0.28
Z1177:Slc47a2 UTSW 11 61328575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCACTGAGGCCATTTCC -3'
(R):5'- CTCATTGAGCTACACCAGCAGCTAC -3'

Sequencing Primer
(F):5'- TCCGGCTTTACCACATCATCAG -3'
(R):5'- TTGTGTCTATAAGCACCCAGG -3'
Posted On2014-08-18