Incidental Mutation 'R0667:Kcnh1'
ID218540
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
MMRRC Submission 038852-MU
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0667 (G1)
Quality Score71
Status Validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 192506038 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 936 (S936T)
Ref Sequence ENSEMBL: ENSMUSP00000106468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844] [ENSMUST00000128619] [ENSMUST00000151152]
Predicted Effect probably benign
Transcript: ENSMUST00000078470
AA Change: S963T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: S963T

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110844
AA Change: S936T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: S936T

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128619
SMART Domains Protein: ENSMUSP00000120479
Gene: ENSMUSG00000037375

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 3.1e-60 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151152
SMART Domains Protein: ENSMUSP00000141247
Gene: ENSMUSG00000058248

DomainStartEndE-ValueType
SCOP:d1rgs_2 1 51 3e-6 SMART
Blast:cNMP 1 55 4e-34 BLAST
PDB:4F8A|A 1 60 1e-38 PDB
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 intron probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R7945:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGCGGAATCACCAAGAGC -3'
(R):5'- TTTCCAGAGACCATGCAGGCAC -3'

Sequencing Primer
(F):5'- ACCTGCGCTTGGACAATG -3'
(R):5'- AAGCCACTTGGTCTGATTTTGAC -3'
Posted On2014-08-18