Incidental Mutation 'R0667:Piwil1'
ID 218544
Institutional Source Beutler Lab
Gene Symbol Piwil1
Ensembl Gene ENSMUSG00000029423
Gene Name piwi-like RNA-mediated gene silencing 1
Synonyms MIWI
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0667 (G1)
Quality Score 51
Status Validated
Chromosome 5
Chromosomal Location 128702524-128755474 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 128741478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086056] [ENSMUST00000195959] [ENSMUST00000200192]
AlphaFold Q9JMB7
Predicted Effect probably null
Transcript: ENSMUST00000086056
SMART Domains Protein: ENSMUSP00000083222
Gene: ENSMUSG00000029423

DomainStartEndE-ValueType
GAGE 1 113 9.14e-25 SMART
Pfam:ArgoL1 228 276 4.6e-8 PFAM
PAZ 278 416 1.04e-76 SMART
Piwi 556 848 6.45e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195959
SMART Domains Protein: ENSMUSP00000142386
Gene: ENSMUSG00000029423

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
PAZ 278 416 1.04e-76 SMART
Piwi 556 831 4.99e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200192
SMART Domains Protein: ENSMUSP00000142807
Gene: ENSMUSG00000029423

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Blast:PAZ 214 280 5e-23 BLAST
PAZ 288 426 8e-81 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIWI subfamily of Argonaute proteins, evolutionarily conserved proteins containing both PAZ and Piwi motifs that play important roles in stem cell self-renewal, RNA silencing, and translational regulation in diverse organisms. The encoded protein may play a role as an intrinsic regulator of the self-renewal capacity of germline and hematopoietic stem cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male sterility due to a block in spermatogenesis beginning at the round spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Piwil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Piwil1 APN 5 128749973 missense possibly damaging 0.95
IGL01783:Piwil1 APN 5 128743826 missense probably benign 0.29
IGL01992:Piwil1 APN 5 128747332 missense probably null 1.00
IGL02079:Piwil1 APN 5 128742003 missense possibly damaging 0.89
IGL02212:Piwil1 APN 5 128750270 missense possibly damaging 0.90
IGL03133:Piwil1 APN 5 128742029 missense probably benign
IGL03352:Piwil1 APN 5 128751072 missense probably benign 0.29
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0032:Piwil1 UTSW 5 128743280 missense probably benign 0.00
R0139:Piwil1 UTSW 5 128747323 missense probably damaging 1.00
R0691:Piwil1 UTSW 5 128743307 missense probably null 1.00
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1146:Piwil1 UTSW 5 128747893 missense probably benign
R1854:Piwil1 UTSW 5 128747839 nonsense probably null
R2126:Piwil1 UTSW 5 128754096 missense probably damaging 0.99
R4878:Piwil1 UTSW 5 128740981 missense probably damaging 0.99
R5068:Piwil1 UTSW 5 128741614 missense probably damaging 0.98
R5413:Piwil1 UTSW 5 128743880 missense possibly damaging 0.80
R5553:Piwil1 UTSW 5 128745501 missense probably benign 0.09
R5936:Piwil1 UTSW 5 128751078 missense probably benign 0.24
R6158:Piwil1 UTSW 5 128747876 nonsense probably null
R7663:Piwil1 UTSW 5 128747433 missense probably benign 0.00
R7772:Piwil1 UTSW 5 128739463 missense probably benign 0.06
R8133:Piwil1 UTSW 5 128749850 missense probably damaging 1.00
R9452:Piwil1 UTSW 5 128747893 missense probably benign
Z1177:Piwil1 UTSW 5 128742086 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTGTTCAGCAGTGGCAGCTTTTC -3'
(R):5'- ACACCTTCCAATGAGGTCTTCATGC -3'

Sequencing Primer
(F):5'- gtctgtctgtctgtctgtctg -3'
(R):5'- TCTTCATGCTGGAAGAGCAG -3'
Posted On 2014-08-18