Incidental Mutation 'R0667:Col6a4'
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0667 (G1)
Quality Score78
Status Validated
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 106029959 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably benign
Transcript: ENSMUST00000121963
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572

signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R7964:Col6a4 UTSW 9 106080298 missense probably benign 0.14
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttaccttcttcatcatcctctcc -3'
Posted On2014-08-18