Incidental Mutation 'R0667:Hkdc1'
ID 218549
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Name hexokinase domain containing 1
Synonyms
MMRRC Submission 038852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R0667 (G1)
Quality Score 49
Status Validated
Chromosome 10
Chromosomal Location 62218916-62258270 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 62247644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
AlphaFold Q91W97
Predicted Effect probably benign
Transcript: ENSMUST00000020277
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159579
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G T 11: 110,218,637 (GRCm39) N76K probably benign Het
Adamts12 C T 15: 11,215,710 (GRCm39) R244C probably damaging Het
Atad2 A G 15: 57,962,115 (GRCm39) S1143P probably benign Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
Cand1 A G 10: 119,052,425 (GRCm39) S234P probably benign Het
Cd200 T A 16: 45,215,220 (GRCm39) I144L probably benign Het
Cep76 A T 18: 67,767,848 (GRCm39) L228Q possibly damaging Het
Col12a1 A G 9: 79,535,744 (GRCm39) L2584S probably damaging Het
Col6a3 A C 1: 90,755,823 (GRCm39) D155E probably damaging Het
Col6a4 G A 9: 105,907,158 (GRCm39) probably benign Het
Dsg2 A C 18: 20,706,556 (GRCm39) D24A possibly damaging Het
Gm5901 G A 7: 105,026,697 (GRCm39) S155N possibly damaging Het
Kansl1 A G 11: 104,234,364 (GRCm39) V714A probably benign Het
Kcnh1 T A 1: 192,188,346 (GRCm39) S936T probably benign Het
Klhdc3 A T 17: 46,988,151 (GRCm39) F205I probably benign Het
Krt31 T A 11: 99,938,951 (GRCm39) H290L probably benign Het
Lama2 T A 10: 27,220,406 (GRCm39) probably null Het
Mep1a T G 17: 43,789,081 (GRCm39) D565A probably benign Het
Mgme1 T A 2: 144,120,907 (GRCm39) probably benign Het
Mtf2 C T 5: 108,252,369 (GRCm39) T409I probably damaging Het
Mylk3 A G 8: 86,081,794 (GRCm39) probably null Het
Myo1c A G 11: 75,559,338 (GRCm39) E650G probably damaging Het
Nipbl A C 15: 8,390,488 (GRCm39) D260E possibly damaging Het
Nufip2 T A 11: 77,582,839 (GRCm39) V251D possibly damaging Het
Or2n1e C A 17: 38,586,048 (GRCm39) P129T probably damaging Het
Or4a2 T C 2: 89,248,032 (GRCm39) I242V probably benign Het
Or7g35 T A 9: 19,496,743 (GRCm39) N303K probably benign Het
Osm G T 11: 4,189,918 (GRCm39) R234L possibly damaging Het
Pabpc1 G A 15: 36,598,275 (GRCm39) A515V probably benign Het
Piwil1 T A 5: 128,818,542 (GRCm39) probably null Het
Pld1 A G 3: 28,133,327 (GRCm39) probably null Het
Plekhg3 C T 12: 76,623,372 (GRCm39) R871C probably damaging Het
Ppfia2 A T 10: 106,749,555 (GRCm39) Y1147F probably damaging Het
Prmt3 A G 7: 49,441,743 (GRCm39) Y240C probably damaging Het
Prr36 G T 8: 4,266,311 (GRCm39) probably benign Het
Ptprd A G 4: 75,875,583 (GRCm39) I908T probably damaging Het
Sae1 A T 7: 16,102,457 (GRCm39) N172K probably damaging Het
Satb1 T G 17: 52,089,889 (GRCm39) Q319H probably damaging Het
Scart2 C G 7: 139,841,450 (GRCm39) S251R possibly damaging Het
Scn2a A T 2: 65,582,340 (GRCm39) I1563F possibly damaging Het
Scn3a C A 2: 65,314,755 (GRCm39) R1102L probably null Het
Serpinb9b T A 13: 33,216,909 (GRCm39) L60* probably null Het
Setd1a A G 7: 127,385,765 (GRCm39) D281G probably damaging Het
Slc8a1 C A 17: 81,956,310 (GRCm39) V243F probably damaging Het
Tgfbr3 A T 5: 107,325,716 (GRCm39) H115Q probably benign Het
Tiam1 C A 16: 89,694,872 (GRCm39) S195I probably damaging Het
Tjp2 A G 19: 24,086,113 (GRCm39) V803A probably benign Het
Ttc5 T A 14: 51,003,415 (GRCm39) Q423L probably benign Het
Tyk2 A C 9: 21,020,167 (GRCm39) V997G probably damaging Het
Uhrf1 T C 17: 56,617,677 (GRCm39) V133A probably benign Het
Vmn2r107 A C 17: 20,575,916 (GRCm39) Y82S possibly damaging Het
Vmn2r93 T C 17: 18,546,503 (GRCm39) F792L probably damaging Het
Vps13c G A 9: 67,858,855 (GRCm39) W2768* probably null Het
Zfp456 A T 13: 67,514,861 (GRCm39) C282S probably benign Het
Zhx1 T C 15: 57,916,561 (GRCm39) N562D possibly damaging Het
Zmynd15 G T 11: 70,355,944 (GRCm39) G481C probably damaging Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62,229,568 (GRCm39) missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62,231,040 (GRCm39) splice site probably benign
IGL01415:Hkdc1 APN 10 62,229,638 (GRCm39) missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62,236,165 (GRCm39) missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62,235,970 (GRCm39) critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62,253,608 (GRCm39) missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62,221,484 (GRCm39) missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62,247,486 (GRCm39) missense probably null 0.04
R0549:Hkdc1 UTSW 10 62,236,019 (GRCm39) missense probably benign
R0751:Hkdc1 UTSW 10 62,234,452 (GRCm39) missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62,227,162 (GRCm39) missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62,253,677 (GRCm39) missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62,253,677 (GRCm39) missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62,235,991 (GRCm39) missense probably benign
R4480:Hkdc1 UTSW 10 62,227,151 (GRCm39) missense probably benign
R4561:Hkdc1 UTSW 10 62,245,618 (GRCm39) missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62,221,622 (GRCm39) missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62,236,242 (GRCm39) missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62,236,133 (GRCm39) missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62,247,304 (GRCm39) missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62,231,053 (GRCm39) intron probably benign
R5138:Hkdc1 UTSW 10 62,234,470 (GRCm39) missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62,253,712 (GRCm39) missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62,244,445 (GRCm39) missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62,229,589 (GRCm39) missense probably benign
R6418:Hkdc1 UTSW 10 62,219,583 (GRCm39) missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62,229,481 (GRCm39) missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62,231,220 (GRCm39) missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62,239,385 (GRCm39) missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62,244,477 (GRCm39) missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62,237,711 (GRCm39) missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62,229,622 (GRCm39) missense probably damaging 1.00
R7395:Hkdc1 UTSW 10 62,221,478 (GRCm39) missense probably damaging 1.00
R8498:Hkdc1 UTSW 10 62,221,662 (GRCm39) missense probably benign
R8777:Hkdc1 UTSW 10 62,234,612 (GRCm39) missense possibly damaging 0.94
R8777-TAIL:Hkdc1 UTSW 10 62,234,612 (GRCm39) missense possibly damaging 0.94
R8894:Hkdc1 UTSW 10 62,244,400 (GRCm39) missense probably damaging 1.00
R8989:Hkdc1 UTSW 10 62,229,544 (GRCm39) missense probably damaging 1.00
R9331:Hkdc1 UTSW 10 62,236,114 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCATTCCCACGGGTGATTTC -3'
(R):5'- TGCAACAGCTTTCTTCCTAGACAGC -3'

Sequencing Primer
(F):5'- CCCACGGGTGATTTCATTGG -3'
(R):5'- aatcaggcagacttgggc -3'
Posted On 2014-08-18