Incidental Mutation 'R0667:Zhx1'
ID218558
Institutional Source Beutler Lab
Gene Symbol Zhx1
Ensembl Gene ENSMUSG00000022361
Gene Namezinc fingers and homeoboxes 1
Synonyms
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0667 (G1)
Quality Score71
Status Validated
Chromosome15
Chromosomal Location58047003-58076541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58053165 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 562 (N562D)
Ref Sequence ENSEMBL: ENSMUSP00000135230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070143] [ENSMUST00000110168] [ENSMUST00000175805] [ENSMUST00000176076] [ENSMUST00000176935] [ENSMUST00000177176] [ENSMUST00000177276] [ENSMUST00000177504]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070143
AA Change: N562D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066201
Gene: ENSMUSG00000022361
AA Change: N562D

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110168
AA Change: N562D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105797
Gene: ENSMUSG00000022361
AA Change: N562D

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175805
AA Change: N562D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134844
Gene: ENSMUSG00000022361
AA Change: N562D

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176270
Predicted Effect probably benign
Transcript: ENSMUST00000176935
SMART Domains Protein: ENSMUSP00000134752
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177176
Predicted Effect possibly damaging
Transcript: ENSMUST00000177276
AA Change: N562D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135230
Gene: ENSMUSG00000022361
AA Change: N562D

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 623 2.77e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177504
SMART Domains Protein: ENSMUSP00000135111
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Zhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zhx1 APN 15 58053315 missense probably damaging 1.00
IGL00819:Zhx1 APN 15 58054694 missense probably benign 0.00
IGL01025:Zhx1 APN 15 58054679 missense probably benign 0.32
IGL01867:Zhx1 APN 15 58054445 missense probably damaging 1.00
IGL02000:Zhx1 APN 15 58054287 missense probably damaging 1.00
IGL02093:Zhx1 APN 15 58052868 missense probably benign
IGL02156:Zhx1 APN 15 58054049 missense possibly damaging 0.89
IGL02399:Zhx1 APN 15 58053741 missense probably damaging 1.00
IGL02479:Zhx1 APN 15 58054371 missense probably damaging 1.00
R1502:Zhx1 UTSW 15 58054596 missense probably damaging 1.00
R2923:Zhx1 UTSW 15 58053681 missense probably damaging 0.99
R3039:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R3401:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3403:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3979:Zhx1 UTSW 15 58053240 missense probably benign 0.14
R4086:Zhx1 UTSW 15 58052921 missense possibly damaging 0.93
R5013:Zhx1 UTSW 15 58054142 missense possibly damaging 0.61
R5124:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5125:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5180:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5181:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5186:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5187:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5408:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5490:Zhx1 UTSW 15 58053299 missense probably damaging 1.00
R5629:Zhx1 UTSW 15 58054811 missense probably damaging 1.00
R6314:Zhx1 UTSW 15 58054002 missense probably benign 0.01
R6768:Zhx1 UTSW 15 58054103 missense probably benign 0.27
R7081:Zhx1 UTSW 15 58054338 missense probably benign 0.00
R7211:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R7219:Zhx1 UTSW 15 58054337 missense probably benign
R7232:Zhx1 UTSW 15 58053069 missense probably benign 0.04
R7275:Zhx1 UTSW 15 58054362 missense probably benign
R7287:Zhx1 UTSW 15 58053296 missense probably damaging 1.00
R7369:Zhx1 UTSW 15 58053300 missense probably damaging 1.00
R7381:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGGTGCAACTGTTTCATCTCCAGG -3'
(R):5'- TCCCCATGACTCAGAGATCATCAGG -3'

Sequencing Primer
(F):5'- ACTGTTTCATCTCCAGGAGAAC -3'
(R):5'- GACTCAGAGATCATCAGGCTTATG -3'
Posted On2014-08-18