Incidental Mutation 'R0667:Satb1'
ID218564
Institutional Source Beutler Lab
Gene Symbol Satb1
Ensembl Gene ENSMUSG00000023927
Gene Namespecial AT-rich sequence binding protein 1
Synonyms
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0667 (G1)
Quality Score23
Status Validated
Chromosome17
Chromosomal Location51736187-51833290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 51782861 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 319 (Q319H)
Ref Sequence ENSEMBL: ENSMUSP00000134957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129667] [ENSMUST00000133574] [ENSMUST00000140979] [ENSMUST00000144331] [ENSMUST00000152830] [ENSMUST00000169480] [ENSMUST00000176669]
Predicted Effect probably damaging
Transcript: ENSMUST00000129667
AA Change: Q319H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116020
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 619 N/A INTRINSIC
HOX 644 707 6.73e-10 SMART
low complexity region 720 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133574
AA Change: Q319H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120536
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140979
AA Change: Q319H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118839
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
Pfam:ULD 72 170 3.2e-40 PFAM
Pfam:CUTL 176 247 1.6e-46 PFAM
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 616 661 N/A INTRINSIC
HOX 676 739 6.73e-10 SMART
low complexity region 752 762 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144331
AA Change: Q319H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116006
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152830
AA Change: Q319H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119842
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169480
AA Change: Q319H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128841
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176669
AA Change: Q319H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134957
Gene: ENSMUSG00000023927
AA Change: Q319H

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a matrix protein which binds nuclear matrix and scaffold-associating DNAs through a unique nuclear architecture. The protein recruits chromatin-remodeling factors in order to regulate chromatin structure and gene expression. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted null mutation exhibit reduced size of the lymphoid organs, abnormal T cell development, general growth retardation and die by 3-4 weeks of age. Mice homozegous for a different targeted allele exhibit postnatal growth retardation and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Satb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Satb1 APN 17 51805289 missense probably damaging 1.00
IGL01658:Satb1 APN 17 51775251 missense probably benign 0.33
IGL02070:Satb1 APN 17 51740067 missense probably damaging 0.98
IGL02212:Satb1 APN 17 51775291 missense possibly damaging 0.82
IGL02971:Satb1 APN 17 51742689 missense possibly damaging 0.62
R0049:Satb1 UTSW 17 51740346 missense probably benign 0.28
R0056:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0060:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0113:Satb1 UTSW 17 51782698 nonsense probably null
R0347:Satb1 UTSW 17 51739906 nonsense probably null
R1436:Satb1 UTSW 17 51804363 unclassified probably null
R1595:Satb1 UTSW 17 51782701 missense possibly damaging 0.82
R1686:Satb1 UTSW 17 51739999 missense probably benign 0.08
R1921:Satb1 UTSW 17 51742115 nonsense probably null
R1952:Satb1 UTSW 17 51740145 missense probably damaging 1.00
R2012:Satb1 UTSW 17 51782788 nonsense probably null
R2156:Satb1 UTSW 17 51740410 missense probably benign 0.02
R2180:Satb1 UTSW 17 51803496 missense probably damaging 0.96
R2959:Satb1 UTSW 17 51775303 missense possibly damaging 0.91
R3107:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3108:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3814:Satb1 UTSW 17 51782907 missense probably damaging 0.98
R4109:Satb1 UTSW 17 51804350 missense probably damaging 0.99
R4727:Satb1 UTSW 17 51804347 missense probably damaging 1.00
R5209:Satb1 UTSW 17 51809207 missense probably benign 0.26
R5652:Satb1 UTSW 17 51742795 missense probably damaging 1.00
R5815:Satb1 UTSW 17 51782953 missense possibly damaging 0.92
R6141:Satb1 UTSW 17 51775376 missense possibly damaging 0.93
R6370:Satb1 UTSW 17 51782797 missense possibly damaging 0.94
R7371:Satb1 UTSW 17 51782980 nonsense probably null
R7409:Satb1 UTSW 17 51809189 missense possibly damaging 0.90
R7471:Satb1 UTSW 17 51783001 missense probably damaging 0.96
R7568:Satb1 UTSW 17 51782724 missense possibly damaging 0.88
R7626:Satb1 UTSW 17 51767967 missense probably benign 0.25
R7749:Satb1 UTSW 17 51767933 missense possibly damaging 0.70
R7863:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
R7946:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
Z1088:Satb1 UTSW 17 51782939 missense probably damaging 0.99
Z1088:Satb1 UTSW 17 51782952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACCTCCGTGTTTGTGGAAACTTG -3'
(R):5'- AGACGCTGGACCTTGGCATCTTAC -3'

Sequencing Primer
(F):5'- TGGAAACTTGCTGCTCCAAAG -3'
(R):5'- GATAGTCTGTCTGAACTATCCCAG -3'
Posted On2014-08-18